0	Crossveinless-2 Is a BMP Feedback Inhibitor that Binds Chordin/, otherFeat=[]-->, belongsTo=title
1	BMP to Regulate Xenopus Embryonic Patterning, otherFeat=[]-->, belongsTo=title
2	Andrea L. Ambrosio1,2, Vincent F. Taelman1,2, Hojoon X. Lee1,2, Carrie Metzinger1,, otherFeat=[]-->, belongsTo=parr
3	Catherine Coffinier1, and E.M. De Robertis1,*, otherFeat=[]-->, belongsTo=parr
4	1 Howard Hughes Medical Institute and Department of Biological Chemistry University of California, otherFeat=[]-->, belongsTo=parr
5	Los Angeles, CA 90095-1662, USA, otherFeat=[]-->, belongsTo=parr
6	SUMMARY, otherFeat=[]-->, belongsTo=title
7	Vertebrate Crossveinless-2 (CV2) is a secreted protein that can potentiate or antagonize BMP, otherFeat=[]-->, belongsTo=parr
8	signaling. Through embryological and biochemical experiments we find that: 1) CV2 functions as a, otherFeat=[]-->, belongsTo=parr
9	BMP4 feedback inhibitor in ventral regions of the Xenopus embryo; 2) CV2 complexes with Twisted, otherFeat=[]-->, belongsTo=parr
10	gastrulation and BMP4; 3) CV2 is not a substrate for tolloid proteinases; 4) CV2 binds to purified, otherFeat=[]-->, belongsTo=parr
11	Chordin protein with high affinity (KD in the 1 nM range); 5) CV2 binds even more strongly to, otherFeat=[]-->, belongsTo=parr
12	Chordin proteolytic fragments resulting from Tolloid digestion or to full-length Chordin/BMP, otherFeat=[]-->, belongsTo=parr
13	complexes; 6) CV2 depletion causes the Xenopus embryo to become hypersensitive to the anti-BMP, otherFeat=[]-->, belongsTo=parr
14	effects of Chordin overexpression or tolloid inhibition. We propose that the CV2/Chordin interaction, otherFeat=[]-->, belongsTo=parr
15	may help coordinate BMP diffusion to the ventral side of the embryo, ensuring that BMPs liberated, otherFeat=[]-->, belongsTo=parr
16	from Chordin inhibition by tolloid proteolysis cause peak signaling levels., otherFeat=[]-->, belongsTo=parr
17	INTRODUCTION, otherFeat=[]-->, belongsTo=title
18	The histotypic differentiation of ectodermal and mesodermal cells along the dorsal-ventral (D-, otherFeat=[]-->, belongsTo=parr
19	V) axis of the Xenopus embryo is determined by the levels of Bone Morphogenetic Proteins, otherFeat=[]-->, belongsTo=parr
20	(BMPs) to which cells are exposed in the extracellular space (reviewed in De Robertis,, otherFeat=[]-->, belongsTo=parr
21	2006). High BMP levels induce differentiation into epidermis or blood, while BMP inhibition, otherFeat=[]-->, belongsTo=parr
22	causes cells to become neural tissue or notochord. In order to develop successfully, the embryo, otherFeat=[]-->, belongsTo=parr
23	has to establish a robust BMP gradient that remains stable throughout gastrulation. It was, otherFeat=[]-->, belongsTo=parr
24	originally thought that this gradient resulted from the simple diffusion of BMP antagonists,, otherFeat=[]-->, belongsTo=parr
25	such as Chordin or Noggin, secreted by a dorsal center called the Spemann organizer (Sasai et, otherFeat=[]-->, belongsTo=parr
26	al., 1995; Zimmerman et al., 1996). More recently, it has been observed that both the dorsal, otherFeat=[]-->, belongsTo=parr
27	and ventral regions of the embryo secrete BMPs and anti-BMP molecules, but under opposite, otherFeat=[]-->, belongsTo=parr
28	transcriptional control (Reversade and De Robertis, 2005)., otherFeat=[]-->, belongsTo=parr
29	Crossveinless-2 (CV2) is one of the genes required for the formation of crossveins in the, otherFeat=[]-->, belongsTo=parr
30	Drosophila wing (Conley et al., 2000; Blair, 2007). Since crossvein determination requires, otherFeat=[]-->, belongsTo=parr
31	high local levels of BMP signals, this indicated that CV2 was involved in the BMP pathway,, otherFeat=[]-->, belongsTo=parr
32	presumably acting as a pro-BMP (Conley et al., 2000). Interestingly, another crossveinless, otherFeat=[]-->, belongsTo=parr
33	mutation, Crossveinless-1 (cv, cv-1) affected a new member of the Twisted Gastrulation family,, otherFeat=[]-->, belongsTo=parr
34	*Correspondence: ederobertis@mednet.ucla.edu Tel. (310) 206-1401 Fax (310) 206-2008., otherFeat=[]-->, belongsTo=parrnote
35	2These authors contributed equally to this work., otherFeat=[]-->, belongsTo=parrnote
36	Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers, otherFeat=[]-->, belongsTo=parrnote
37	we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting, otherFeat=[]-->, belongsTo=parrnote
38	proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could, otherFeat=[]-->, belongsTo=nota_cab_pie
39	affect the content, and all legal disclaimers that apply to the journal pertain., otherFeat=[]-->, belongsTo=nota_cab_pie
40	NIH Public Access, otherFeat=[]-->, belongsTo=nota_cab_pie
41	Author Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
42	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=title
43	Published in final edited form as:, otherFeat=[]-->, belongsTo=parr
44	Dev Cell. 2008 August ; 15(2): 248?260. doi:10.1016/j.devcel.2008.06.013., otherFeat=[]-->, belongsTo=parr
45	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
46	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
47	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
48	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
49	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
50	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
51	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
52	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
53	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
54	dTsg-2 (Vilmos et al., 2005; Shimmi et al., 2005). The cloning of Drosophila CV2 cDNA by, otherFeat=[]-->, belongsTo=parr
55	the Blair group revealed that it was structurally related to a family of proteins such as Chordin,, otherFeat=[]-->, belongsTo=parr
56	Sog, and Kielin that contain CR (Cysteine-Rich, also called vWFc domains) modules known, otherFeat=[]-->, belongsTo=parr
57	to bind BMPs (Conley et al., 2000). CV2 contains 5 CR domains and a partial von Willebrand, otherFeat=[]-->, belongsTo=parr
58	Factor D (vWFd) domain that is involved in interactions with cell surface proteins (Serpe et, otherFeat=[]-->, belongsTo=parr
59	al., 2008). In vertebrates, a mouse homologue had a similar overall structure, except for an, otherFeat=[]-->, belongsTo=parr
60	additional carboxy-terminal Trypsin Inhibitor-like (TIL) domain (Coffinier et al., 2002)., otherFeat=[]-->, belongsTo=parr
61	Although the ability of CV2 to bind BMPs is very clear (Rentzsch et al., 2006; Zhang et al.,, otherFeat=[]-->, belongsTo=parr
62	2007), CV2's effects on signaling overall can vary. On the one hand, CV2 has been shown to, otherFeat=[]-->, belongsTo=parr
63	function in vivo as a pro-BMP molecule during mouse organogenesis (Ikeya et al., 2006),, otherFeat=[]-->, belongsTo=parr
64	zebrafish gastrulation (Rentzsch et al., 2006), and crossvein formation in the fly wing (Conley, otherFeat=[]-->, belongsTo=parr
65	et al., 2000; Ralston and Blair, 2005; O'Connor et al., 2006). On the other hand, potent, otherFeat=[]-->, belongsTo=parr
66	inhibitory activity of CV2 on BMPs has been described during endothelial cell differentiation, otherFeat=[]-->, belongsTo=parr
67	(Moser et al., 2003), frog embryogenesis (Coles et al., 2004), human osteogenic differentiation, otherFeat=[]-->, belongsTo=parr
68	(Binnerts et al., 2004) and in biochemical studies (Zhang et al., 2007). Thus, CV2 displays, otherFeat=[]-->, belongsTo=parr
69	opposing activities depending on the biological context in which it is studied. This investigation, otherFeat=[]-->, belongsTo=parr
70	was undertaken to clarify the mechanistic bases for these divergent functions., otherFeat=[]-->, belongsTo=parr
71	We examined CV2 activity in vivo and in vitro using embryological and biochemical assays, otherFeat=[]-->, belongsTo=parr
72	that lead us to conclude that the overall function of CV2 during Xenopus D-V development is, otherFeat=[]-->, belongsTo=parr
73	to serve as a local BMP feedback inhibitor. When Chordin is depleted, the transcriptional, otherFeat=[]-->, belongsTo=parr
74	upregulation of CV2 lowers BMP signaling levels in the ventral side of the embryo; when both, otherFeat=[]-->, belongsTo=parr
75	CV2 and Chordin are depleted, severe ventralization of embryonic pattern occurs. We, otherFeat=[]-->, belongsTo=parr
76	investigated the interactions of CV2 with other proteins involved in D-V patterning and found, otherFeat=[]-->, belongsTo=parr
77	that CV2 forms a ternary complex with BMP4 and Tsg. Intriguingly, we also discovered that, otherFeat=[]-->, belongsTo=parr
78	CV2 binds to full-length Chordin protein, and even more strongly to Chordin cleavage, otherFeat=[]-->, belongsTo=parr
79	fragments resulting from digestion by tolloid metalloproteinases. Finally, in vivo experiments, otherFeat=[]-->, belongsTo=parr
80	demonstrated that when CV2 was depleted, the anti-BMP activity of overexpressed Chordin, otherFeat=[]-->, belongsTo=parr
81	or of dominant-negative tolloids (DN-Xlr) was enhanced. Thus, in addition to its role as a, otherFeat=[]-->, belongsTo=parr
82	feedback inhibitor, CV2 exerts pro-BMP effects via some form of Chordin antagonism. We, otherFeat=[]-->, belongsTo=parr
83	propose that the action of CV2 on BMP/Chordin diffusion to the ventral side of the gastrula, otherFeat=[]-->, belongsTo=parr
84	explains in part the pro-BMP effects of CV2., otherFeat=[]-->, belongsTo=parr
85	RESULTS, otherFeat=[]-->, belongsTo=title
86	CV2 Is a BMP Feedback Inhibitor in Xenopus, otherFeat=[]-->, belongsTo=parr
87	In Xenopus, CV2 transcripts are expressed in regions of high BMP signaling (such as the ventral, otherFeat=[]-->, belongsTo=parr
88	blastopore; see Figure 1A and Supplementary Figure S1), as is the case for mouse and zebrafish, otherFeat=[]-->, belongsTo=parr
89	CV2 (Coffinier et al., 2002; Rentzsch et al., 2006). We generated a morpholino oligomer, otherFeat=[]-->, belongsTo=parr
90	against CV2 (CV2 MO) that targets the first 25 nucleotides of the CV2 mRNA coding sequence., otherFeat=[]-->, belongsTo=parr
91	CV2 MO inhibited the translation of microinjected xCV2 mRNA (Figure S4A). Its effects were, otherFeat=[]-->, belongsTo=parr
92	specific, since the CV2 MO phenotype could be rescued by the co-injection of mouse CV2, otherFeat=[]-->, belongsTo=parr
93	mRNA (Figure S4B-C), and similar phenotypes were observed with two other CV2 MOs that, otherFeat=[]-->, belongsTo=parr
94	targeted non-overlapping sequences in the CV2 5 untranslated region (see Methods). In CV2, otherFeat=[]-->, belongsTo=parr
95	MO injected embryos, ventral expression of CV2 transcripts was increased (Figure 1B)., otherFeat=[]-->, belongsTo=parr
96	Additional high-BMP markers such as Vent-1 and Sizzled were also increased (Figures 1D, 2D, otherFeat=[]-->, belongsTo=parr
97	inset, and 2E), while dorso-anterior (low-BMP) markers such as Six3, Goosecoid and, otherFeat=[]-->, belongsTo=parr
98	Chordin were decreased (Figures 1E, 2G and 2H). To determine whether the transcriptional, otherFeat=[]-->, belongsTo=parr
99	upregulation of ventral genes was caused by higher levels of BMP4 signaling, BMP4 MO was, otherFeat=[]-->, belongsTo=parr
100	co-injected with CV2 MO. Depletion of BMP4 abolished the increase of CV2 transcripts, otherFeat=[]-->, belongsTo=parr
101	caused by CV2 depletion (Figure 1A to 1C). In addition, we examined the levels of, otherFeat=[]-->, belongsTo=parr
102	phosphorylation of Smad1, an effector protein phosphorylated in response to BMP activity., otherFeat=[]-->, belongsTo=parr
103	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
104	Page 2, otherFeat=[]-->, belongsTo=nota_cab_pie
105	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
106	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
107	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
108	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
109	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
110	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
111	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
112	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
113	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
114	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
115	Xenopus embryos depleted of CV2 showed increased levels of Smad1 phosphorylation, when, otherFeat=[]-->, belongsTo=parr
116	compared to uninjected controls incubated for the same times (Figure 1F). Note that at three, otherFeat=[]-->, belongsTo=parr
117	stages of gastrula and neurula, pSmad1 levels were consistently higher in CV2 MO embryos., otherFeat=[]-->, belongsTo=parr
118	We conclude from these experiments that the overall function of CV2 in the Xenopus embryo, otherFeat=[]-->, belongsTo=parr
119	is to serve as a BMP4 antagonist induced by BMP signaling. In other words, CV2 is a feedback, otherFeat=[]-->, belongsTo=parr
120	inhibitor of BMP4 signaling., otherFeat=[]-->, belongsTo=parr
121	That said, it is important to note that at later developmental stages, CV2 morphants displayed, otherFeat=[]-->, belongsTo=parr
122	a reduction of structures such as the head, eyes, cement gland, endoderm, and dorsal and ventral, otherFeat=[]-->, belongsTo=parr
123	fins (Figures S1?S3). These phenotypes are generally indicative of pro-BMP effects (see also, otherFeat=[]-->, belongsTo=parr
124	Little and Mullins, 2006). We will further address the pro-BMP effects of CV2 in Figure 6., otherFeat=[]-->, belongsTo=parr
125	CV2 and Chordin Have Similar In Vivo Activities, otherFeat=[]-->, belongsTo=parr
126	Since CV2 and Chordin are secreted BMP4 antagonists expressed on opposite sides of the, otherFeat=[]-->, belongsTo=parr
127	embryo, we next tested whether one gene could ameliorate the loss of the other by depleting, otherFeat=[]-->, belongsTo=parr
128	CV2 and Chordin simultaneously. Knockdown of either CV2 or Chordin alone increased levels, otherFeat=[]-->, belongsTo=parr
129	of CV2 and Szl transcripts in the ventral side (Figure 2A to 2F) and inhibited the dorsal genes, otherFeat=[]-->, belongsTo=parr
130	Goosecoid and Chordin (Figure 2G and 2H). Double depletion of CV2 and Chordin caused an, otherFeat=[]-->, belongsTo=parr
131	increase of these effects on D-V marker genes (Figure 2D to 2H). The increase in BMP, otherFeat=[]-->, belongsTo=parr
132	ventralizing signals in double CV2 and Chordin morphants was confirmed by endogenous, otherFeat=[]-->, belongsTo=parr
133	Smad1/5/8 phosphorylation levels at mid gastrula (Figure 2I). These results suggest that when, otherFeat=[]-->, belongsTo=parr
134	Chordin is depleted (Oelgeschl?ger et al., 2003), the transcriptional upregulation of the BMP, otherFeat=[]-->, belongsTo=parr
135	antagonist CV2 on the ventral side, induced by the increase in BMP signaling, replaces the, otherFeat=[]-->, belongsTo=parr
136	loss of Chordin, partially restoring the BMP gradient. We conclude that the overall function, otherFeat=[]-->, belongsTo=parr
137	of CV2 and Chordin is to antagonize BMP signaling from opposite sides of the embryo., otherFeat=[]-->, belongsTo=parr
138	CV2 is not Cleaved by Tolloid, otherFeat=[]-->, belongsTo=parr
139	Chordin activity is controlled through proteolysis by members of the tolloid (Tld) family, otherFeat=[]-->, belongsTo=parr
140	(Piccolo et al., 1997). In Xenopus, these metalloproteinases include Xolloid-related (Xlr) and, otherFeat=[]-->, belongsTo=parr
141	BMP1 (Dale et al., 2002). The analysis of secreted CV2 had shown that CV2 protein is cleaved, otherFeat=[]-->, belongsTo=parr
142	into two fragments covalently bound by a disulfide bridge (Binnerts et al., 2004; Kamimura et, otherFeat=[]-->, belongsTo=parr
143	al., 2004). In zebrafish, it was suggested that CV2 function is regulated by proteolysis, and that, otherFeat=[]-->, belongsTo=parr
144	this cleavage would switch CV2 activity from an anti-BMP to a pro-BMP molecule in the, otherFeat=[]-->, belongsTo=parr
145	extracellular space (Rentzsch et al., 2006). However, the CV2 cleavage site maps to the, otherFeat=[]-->, belongsTo=parr
146	sequence GDPH (Rentzsch et al., 2006). In the mucins, GDPH constitutes a motif that marks, otherFeat=[]-->, belongsTo=parr
147	post-translational autocatalytical cleavage by a non-enzymatic mechanism triggered by the low, otherFeat=[]-->, belongsTo=parr
148	pH present in the secretory pathway (Lidell et al., 2003). Interestingly, CV2 proteins from all, otherFeat=[]-->, belongsTo=parr
149	species sequenced, which include Drosophila, zebrafish, mouse, chick, and Xenopus, contain, otherFeat=[]-->, belongsTo=parr
150	a conserved GDPH motif in their vWFd domain (Figure 2J and data not shown)., otherFeat=[]-->, belongsTo=parr
151	We compared the digestion profile of Chordin and CV2 proteins by the tolloid, otherFeat=[]-->, belongsTo=parr
152	metalloproteinases Xlr and BMP1. After 18 hours of incubation at 30?C, full-length Chordin, otherFeat=[]-->, belongsTo=parr
153	was completely digested by either enzyme (Figure 2K, lanes 1?3), whereas CV2 was entirely, otherFeat=[]-->, belongsTo=parr
154	resistant to proteolysis by Xlr or BMP1 (Figures 2K, lanes 4?6). Purified mouse CV2 protein, otherFeat=[]-->, belongsTo=parr
155	(R&D Systems) consisted of three bands in reducing SDS gels followed by Western blot using, otherFeat=[]-->, belongsTo=parr
156	an anti-mouse CV2 antibody (Figure 2K, lane 4). The most prominent bands corresponded to, otherFeat=[]-->, belongsTo=parr
157	the N-terminal and C-terminal fragments (50 and 37 kDa, respectively), and the 80 kDa upper, otherFeat=[]-->, belongsTo=parr
158	band corresponded to the full-length form. When purified CV2 protein was incubated in the, otherFeat=[]-->, belongsTo=parr
159	absence of enzyme for 18 hours at 37?C in buffers of pH ranging from 7.5 to 4.5, disappearance, otherFeat=[]-->, belongsTo=parr
160	of full-length CV2 was observed at a pH equal or lower than pH 5.5 (Figure 2K, lanes 7?10)., otherFeat=[]-->, belongsTo=parr
161	These results strongly suggest that CV2 is autocatalytically processed in the secretory pathway, otherFeat=[]-->, belongsTo=parr
162	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
163	Page 3, otherFeat=[]-->, belongsTo=nota_cab_pie
164	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
165	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
166	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
167	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
168	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
169	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
170	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
171	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
172	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
173	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
174	(Lidell et al., 2003) and is not proteolytically digested in the extracellular space by tolloid, otherFeat=[]-->, belongsTo=parr
175	proteinases., otherFeat=[]-->, belongsTo=parr
176	We next reinvestigated whether the switch between the pro-BMP and anti-BMP activities of, otherFeat=[]-->, belongsTo=parr
177	CV2 could be explained by proteolytic processing. This notion was based on experiments in, otherFeat=[]-->, belongsTo=parr
178	which a zebrafish mRNA construct consisting only of the N-terminal CR BMP-binding, otherFeat=[]-->, belongsTo=parr
179	modules revealed strong pro-BMP effects (Rentzsch et al., 2006). We prepared similar, otherFeat=[]-->, belongsTo=parr
180	constructs for Xenopus CV2 terminating at the GDPH cleavage site, or consisting of a secreted, otherFeat=[]-->, belongsTo=parr
181	form of the vWFd domain (Figure 2J). Ventral microinjection of full-length CV2 mRNA into, otherFeat=[]-->, belongsTo=parr
182	Xenopus 8-cell embryos caused secondary axis formation (Figure 2L). However, neither the, otherFeat=[]-->, belongsTo=parr
183	N-terminal nor the C-terminal fragments of the extracellular domain had any phenotypic effects, otherFeat=[]-->, belongsTo=parr
184	(Figure 2M and 2N). Constructs of mouse (data not shown) CV2 CR domains were also devoid, otherFeat=[]-->, belongsTo=parr
185	of activity (except for a weak anti-BMP activity, resulting in a posteriorized anus phenotype,, otherFeat=[]-->, belongsTo=parr
186	observed for the mouse CV-2 N-terminal construct, data not shown). Thus, we were unable to, otherFeat=[]-->, belongsTo=parr
187	confirm a role for regulated proteolysis in switching CV2 into a pro-BMP function. In, otherFeat=[]-->, belongsTo=parr
188	Drosophila, it has also been recently reported that proteolytic cleavage of CV2 is not required, otherFeat=[]-->, belongsTo=parr
189	for its pro-BMP activity, and that a fragment consisting of the only CV2 CR domains is inactive, otherFeat=[]-->, belongsTo=parr
190	(Serpe et al., 2008). We conclude that both the CR modules and the vWFd domain are required, otherFeat=[]-->, belongsTo=parr
191	for the BMP-modulating activity of Xenopus and mouse CV2., otherFeat=[]-->, belongsTo=parr
192	Depletion of CV2 Reveals the Pro-BMP Activity of Tsg, otherFeat=[]-->, belongsTo=parr
193	It has been shown that Tsg can have either an anti-BMP or a pro-BMP activity depending on, otherFeat=[]-->, belongsTo=parr
194	the presence of Chordin (Oelgeschl?ger et al., 2000; Larra?n et al., 2001; Little and Mullins,, otherFeat=[]-->, belongsTo=parr
195	2004; Xie and Fisher, 2005). We next examined the effect of knocking down Tsg in the context, otherFeat=[]-->, belongsTo=parr
196	of Xenopus embryos depleted of both CV2 and Chordin. Double morphant embryos displayed, otherFeat=[]-->, belongsTo=parr
197	a very large increase in BMP signaling levels reflected by up-regulation of CV2 expression, otherFeat=[]-->, belongsTo=parr
198	(Figure 3A). However, when Tsg was also depleted by Tsg MO co-injection, CV2 expression, otherFeat=[]-->, belongsTo=parr
199	almost disappeared (Figure 3B; see Figure S5 for a complete set of controls for these, otherFeat=[]-->, belongsTo=parr
200	experiments). These experiments reveal a potent pro-BMP activity for endogenous Tsg in the, otherFeat=[]-->, belongsTo=parr
201	absence of CV2 and Chordin in Xenopus embryos., otherFeat=[]-->, belongsTo=parr
202	Tsg Increases the Anti-BMP Activity of CV2, otherFeat=[]-->, belongsTo=parr
203	To show that Tsg is also important for inhibiting BMP signaling, we examined the effects of, otherFeat=[]-->, belongsTo=parr
204	Tsg gain-of function and loss-of-function in embryos injected with CV2 protein into the, otherFeat=[]-->, belongsTo=parr
205	blastocoele. The phenotype obtained after CV2 injection (using the same predominantly, otherFeat=[]-->, belongsTo=parr
206	cleaved protein preparation shown in Figure 2K, lane 4) was a dorsalized (low-BMP) embryo, otherFeat=[]-->, belongsTo=parr
207	with a shortened axis, enlarged head and increased expression of dorsal-anterior markers such, otherFeat=[]-->, belongsTo=parr
208	as Six3, Xag1, Krox20, and Sox3 (Figure 3C and E). When CV2 protein was injected into Tsg-, otherFeat=[]-->, belongsTo=parr
209	depleted embryos, they were much less affected and displayed almost normal levels of dorsal, otherFeat=[]-->, belongsTo=parr
210	marker genes (Figure 3D, compare to 3C). In overexpression experiments, co-injection of Tsg, otherFeat=[]-->, belongsTo=parr
211	and CV2 proteins showed cooperation between the two proteins, with an expansion of the pan-, otherFeat=[]-->, belongsTo=parr
212	neural Sox3 marker, indicating lower levels of BMP signaling (Figure 3F). Taken together,, otherFeat=[]-->, belongsTo=parr
213	these results indicate that Tsg is required for CV2 protein to display its anti-BMP effect. This, otherFeat=[]-->, belongsTo=parr
214	finding is in some ways analogous to previous studies of Tsg and Chordin; we therefore sought, otherFeat=[]-->, belongsTo=parr
215	to determine whether the underlying biochemistry is also analogous., otherFeat=[]-->, belongsTo=parr
216	CV2 Forms a Ternary Complex with Tsg and BMP4, otherFeat=[]-->, belongsTo=parr
217	CV2 bound BMP4, and this binding was specific as it could be competed by a 10-fold excess, otherFeat=[]-->, belongsTo=parr
218	of BMP2, but not of TGF-1 or Nodal, in immunoprecipitation assays (Figure 4A and data not, otherFeat=[]-->, belongsTo=parr
219	shown). In addition, BMP4 signaling in L-cell fibroblasts was inhibited by pre-incubation with, otherFeat=[]-->, belongsTo=parr
220	CV2 protein in a dose-dependent way (Figure 4B). BMP binding and its inhibition by CV2, otherFeat=[]-->, belongsTo=parr
221	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
222	Page 4, otherFeat=[]-->, belongsTo=nota_cab_pie
223	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
224	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
225	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
226	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
227	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
228	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
229	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
230	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
231	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
232	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
233	had been observed previously (Moser et al., 2003; Coles et al., 2004; Binnerts et al., 2004;, otherFeat=[]-->, belongsTo=parr
234	Zhang et al., 2007)., otherFeat=[]-->, belongsTo=parr
235	We investigated Tsg/CV2 interactions by performing co-immunoprecipitation experiments in, otherFeat=[]-->, belongsTo=parr
236	which anti-CV2 antibody was bound to protein G beads. These beads were added to a mixture, otherFeat=[]-->, belongsTo=parr
237	of CV2 and Tsg proteins, which bound to each other in solution (Figure 4C, lane 2). We first, otherFeat=[]-->, belongsTo=parr
238	tested whether Tsg was able to influence the binding of BMP4 to CV2 using this CV2 pull-, otherFeat=[]-->, belongsTo=parr
239	down assay. Increasing amounts of BMP4 were pre-incubated with CV2 in the presence of a, otherFeat=[]-->, belongsTo=parr
240	constant amount of Tsg (Figure 4D). BMP4 bound better in the presence of Tsg (Figure 4D,, otherFeat=[]-->, belongsTo=parr
241	lanes 5?7), indicating that Tsg protein facilitates the binding of BMP4 to CV2. This was similar, otherFeat=[]-->, belongsTo=parr
242	to what has been reported for Chordin/BMP4/Tsg complexes (Oelgeschl?ger et al., 2000; Ross, otherFeat=[]-->, belongsTo=parr
243	et al., 2001; Larra?n et al., 2001), otherFeat=[]-->, belongsTo=parr
244	Given the similar structure and activities of Chordin and CV2, we asked whether a CV2-Tsg-, otherFeat=[]-->, belongsTo=parr
245	BMP4 ternary complex was formed. To do so, we chemically cross-linked a pre-incubated, otherFeat=[]-->, belongsTo=parr
246	mixture of CV2, Tsg and BMP4 proteins with DSS. We identified a complex recognized by, otherFeat=[]-->, belongsTo=parr
247	antibodies specific for either CV2 or BMP4, which was only formed in samples containing the, otherFeat=[]-->, belongsTo=parr
248	three proteins (Figure 4E). We conclude that CV2, like Chordin, forms a ternary complex, otherFeat=[]-->, belongsTo=parr
249	together with BMP4 and Tsg. This interaction may help explain why Drosophila mutations in, otherFeat=[]-->, belongsTo=parr
250	the either the cv-2 or dTsg2 (cv, cv-1) genes produce identical crossveinless phenotypes in the, otherFeat=[]-->, belongsTo=parr
251	fly wing (Conley et al., 2000; Shimmi et al., 2005; Vilmos et al., 2005)., otherFeat=[]-->, belongsTo=parr
252	CV2 Inhibits the Binding of BMP4 to BMPR-1b, otherFeat=[]-->, belongsTo=parr
253	To test whether CV2 functions as an antagonist by preventing the binding of BMP4 to its, otherFeat=[]-->, belongsTo=parr
254	receptor, we used a soluble BMPR-1b protein fused to an immunoglobulin constant region, otherFeat=[]-->, belongsTo=parr
255	(BMPR-1b-Fc). The preincubation of BMP4 with CV2 was able to partially inhibit BMP4, otherFeat=[]-->, belongsTo=parr
256	binding to this receptor (Figure 4F, compare lanes 1 and 2), in agreement with other, otherFeat=[]-->, belongsTo=parr
257	biochemical studies showing that a CV2 domain blocks binding to BMPRs type I and II (Zhang, otherFeat=[]-->, belongsTo=parr
258	et al., 2008). The CV2 inhibitory effect was increased additively when the same experiment, otherFeat=[]-->, belongsTo=parr
259	was performed in the presence of Tsg (Figure 4F, lane 4). These in vitro experiments tested, otherFeat=[]-->, belongsTo=parr
260	only the inhibition of binding BMP4 to BMPR-1b and do not exclude binding of CV2 to BMP, otherFeat=[]-->, belongsTo=parr
261	receptors such as BMPR-1a (Serpe et al., 2008). Figure 4G shows a model of how a CV2/Tsg/, otherFeat=[]-->, belongsTo=parr
262	BMP4 ternary complex could serve as a negative feedback regulator of BMP signaling in the, otherFeat=[]-->, belongsTo=parr
263	ventral region of the embryo., otherFeat=[]-->, belongsTo=parr
264	CV2 Binds to Chordin, otherFeat=[]-->, belongsTo=parr
265	Mutations affecting crossvein formation in the fly wing have suggested that both Sog and CV2, otherFeat=[]-->, belongsTo=parr
266	are required for reaching peak BMP signalling in the presumptive territory of the crossvein, otherFeat=[]-->, belongsTo=parr
267	(Ralston and Blair, 2005; O'Connor et al., 2006; Blair, 2007). This suggested to us that direct, otherFeat=[]-->, belongsTo=parr
268	molecular interactions between Chordin and CV2 might exist. Using surface plasmon, otherFeat=[]-->, belongsTo=parr
269	resonance (Biacore) we found that CV2 bound to Chordin protein immobilized on a sensor, otherFeat=[]-->, belongsTo=parr
270	chip (Figure 5A) or in solution in pull-down assays (Figure S6). Purified CV2 bound to Chordin, otherFeat=[]-->, belongsTo=parr
271	with very high affinity, with a KD in the low nanomolar range (1.4 ? 0.4 nM) (Figure 5A). To, otherFeat=[]-->, belongsTo=parr
272	our surprise, pull-down assays also showed that Chordin pre-incubated with BMP4 bound, otherFeat=[]-->, belongsTo=parr
273	much better to CV2 pre-bound to antibody beads (Figure 5B, compare lanes 2 and 3). We, otherFeat=[]-->, belongsTo=parr
274	conclude from these results that purified Chordin can bind to CV2 in the 1 nM affinity range., otherFeat=[]-->, belongsTo=parr
275	CV2 Binds with Higher Affinity to Chordin Cleaved by Tolloid, otherFeat=[]-->, belongsTo=parr
276	We next investigated whether a molecular complex of CV2-Chordin-BMP4 might be formed., otherFeat=[]-->, belongsTo=parr
277	To answer this question biochemically, we pre-incubated the three proteins prior to, otherFeat=[]-->, belongsTo=parr
278	crosslinking with DSS. We were able to identify, using anti-BMP4 or anti-Chordin antibodies,, otherFeat=[]-->, belongsTo=parr
279	a high molecular weight complex which formed only in the presence of the three proteins, otherFeat=[]-->, belongsTo=parr
280	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
281	Page 5, otherFeat=[]-->, belongsTo=nota_cab_pie
282	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
283	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
284	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
285	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
286	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
287	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
288	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
289	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
290	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
291	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
292	(Figure 5C, lanes 4 and 8). This suggested that Chordin, BMP4 and CV2 can indeed form a, otherFeat=[]-->, belongsTo=parr
293	tri-molecular complex. (Attempts to identify quaternary complexes containing also Tsg failed, otherFeat=[]-->, belongsTo=parr
294	due to the formation of high molecular weight aggregates.), otherFeat=[]-->, belongsTo=parr
295	We next asked whether CV2 bound equally to full-length Chordin or to its proteolytic cleavage, otherFeat=[]-->, belongsTo=parr
296	fragments. Chordin is specifically cleaved by metalloproteinases from the tolloid family,, otherFeat=[]-->, belongsTo=parr
297	predominantly by the ventrally-expressed Xlr (Dale et al., 2002; Lee et al., 2006). This, otherFeat=[]-->, belongsTo=parr
298	mechanism is crucial in D-V patterning because it releases active BMPs from Chordin (Piccolo, otherFeat=[]-->, belongsTo=parr
299	et al., 1997). CV2 is expressed in the ventral side of the embryo, in a region overlapping with, otherFeat=[]-->, belongsTo=parr
300	the Xlr expression domain, but it is not itself digested by this enzyme. Using affinity-purified, otherFeat=[]-->, belongsTo=parr
301	Xlr enzyme (Lee et al., 2006), we digested Xenopus Chordin for 15 min or 2 h (Figure 5D),, otherFeat=[]-->, belongsTo=parr
302	and incubated the digested samples with CV2 pre-bound to beads. Using an anti-Chordin, otherFeat=[]-->, belongsTo=parr
303	antibody that recognizes the Chordin internal fragment (anti-I-Chordin; Piccolo et al., 1997),, otherFeat=[]-->, belongsTo=parr
304	it was found that the full-length protein, as well as minor cleaved bands present in the untreated, otherFeat=[]-->, belongsTo=parr
305	Chordin sample (which became enriched with respect to the full length protein during this, otherFeat=[]-->, belongsTo=parr
306	procedure), could be pulled down by the CV2 beads (Figure 5D, lanes 1 and 2, see middle, otherFeat=[]-->, belongsTo=parr
307	panel). After digestion with Xlr, the resulting Chordin proteolytic fragments showed a much, otherFeat=[]-->, belongsTo=parr
308	higher affinity for CV2; this was particularly striking for the Chordin middle fragment lacking, otherFeat=[]-->, belongsTo=parr
309	both CR1 and CR4 (Figure 5D, compare lanes 2 and 3 in the middle western blot panel)., otherFeat=[]-->, belongsTo=parr
310	In addition, we investigated the effect of BMP4 on the affinity of Chordin for CV2 pre-bound, otherFeat=[]-->, belongsTo=parr
311	on antibody beads. The experiment in Figure 5E shows that even at exposure levels at which, otherFeat=[]-->, belongsTo=parr
312	the binding of uncleaved Chordin to CV2 was so low as to be undetectable, the affinity of pre-, otherFeat=[]-->, belongsTo=parr
313	incubated full-length Chordin/BMP4 complex for CV2 on beads was greatly increased (Figure, otherFeat=[]-->, belongsTo=parr
314	5E, compare lanes 2 and 4). This experiment also confirmed that the affinity of Chordin binding, otherFeat=[]-->, belongsTo=parr
315	is enhanced by Xlr digestion (Figure 5E, compare lanes 2 and 3). We conclude from these, otherFeat=[]-->, belongsTo=parr
316	biochemical experiments that although CV2 is able to bind full-length Chordin protein, it binds, otherFeat=[]-->, belongsTo=parr
317	better to the Chordin cleavage products resulting from Tolloid digestion or to full-length, otherFeat=[]-->, belongsTo=parr
318	Chordin complexed with BMP4., otherFeat=[]-->, belongsTo=parr
319	Biological Interactions between CV2 and Chordin, otherFeat=[]-->, belongsTo=parr
320	We unexpectedly discovered that CV2 and Chordin had strong interactions in vitro. In order, otherFeat=[]-->, belongsTo=parr
321	to determine whether these biochemical observations had in vivo relevance, we analyzed the, otherFeat=[]-->, belongsTo=parr
322	phenotypic effects of Chordin overexpression in CV2-depleted embryos. As shown earlier, otherFeat=[]-->, belongsTo=parr
323	(Figures 1 and 2), morpholino experiments had revealed primarily anti-BMP effects for, otherFeat=[]-->, belongsTo=parr
324	endogenous CV2 in early Xenopus embryos. However, when CV2-depleted embryos were, otherFeat=[]-->, belongsTo=parr
325	challenged by microinjection of 28 ng of recombinant Chordin protein into the blastocoele just, otherFeat=[]-->, belongsTo=parr
326	before gastrulation (stage 9.5), the anti-BMP effects of Chordin were markedly increased, as, otherFeat=[]-->, belongsTo=parr
327	reflected by the expansion of the eye marker Rx2a and the forebrain/midbrain marker, Otx2, otherFeat=[]-->, belongsTo=parr
328	(Figure 6A to F). Quantitative RT-PCR analyses of the dorsal marker Chordin and the ventral, otherFeat=[]-->, belongsTo=parr
329	markers CV2 and Sizzled confirmed that the dorsalizing effect of Chordin microinjection was, otherFeat=[]-->, belongsTo=parr
330	enhanced by CV2 MO (Figure 6G to 6I). Thus, the depletion of CV2 greatly sensitized the, otherFeat=[]-->, belongsTo=parr
331	embryo to the effects of exogenous Chordin protein., otherFeat=[]-->, belongsTo=parr
332	We next asked whether increasing the levels of endogenous Chordin would also reveal, otherFeat=[]-->, belongsTo=parr
333	biological interactions between Chordin and CV2. Tolloid metalloproteinases play a key, otherFeat=[]-->, belongsTo=parr
334	regulatory role in D-V patterning, and efficient dominant-negative tolloids are available (Lee, otherFeat=[]-->, belongsTo=parr
335	et al., 2006). DN-Xlr mRNA (microinjected four times around the entire embryo), which, otherFeat=[]-->, belongsTo=parr
336	partially inhibits its Chordin degradation, expanded the domain of expression of the anterior, otherFeat=[]-->, belongsTo=parr
337	and dorsal marker Otx2. However, this anti-BMP phenotype (caused by increased stability of, otherFeat=[]-->, belongsTo=parr
338	endogenous Chordin) was enhanced in embryos depleted of CV2 (Figure 6J to 6L). As shown, otherFeat=[]-->, belongsTo=parr
339	earlier, the depletion of CV2 alone causes partially ventralized phenotypes (Figures 1 and 2B), otherFeat=[]-->, belongsTo=parr
340	which reflect an overall anti-BMP function for CV2, and these anti-BMP effects were greatly, otherFeat=[]-->, belongsTo=parr
341	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
342	Page 6, otherFeat=[]-->, belongsTo=nota_cab_pie
343	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
344	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
345	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
346	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
347	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
348	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
349	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
350	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
351	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
352	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
353	potentiated in double CV2/Chd morphants (Figure 2D). Thus, while low levels of Chordin and, otherFeat=[]-->, belongsTo=parr
354	CV2 cooperate with one another as BMP antagonists, CV2 can also dampen the activity of, otherFeat=[]-->, belongsTo=parr
355	excess Chordin. This latter activity may also be relevant to some of the pro-BMP effects, otherFeat=[]-->, belongsTo=parr
356	observed in Figures S1?S3., otherFeat=[]-->, belongsTo=parr
357	The most remarkable aspect of the Chordin or DN-Xlr overexpression results is that the overall, otherFeat=[]-->, belongsTo=parr
358	effect of endogenous CV2 on signaling is switched from negative (anti-BMP) to positive (anti-, otherFeat=[]-->, belongsTo=parr
359	Chordin, pro-BMP) when Chordin levels are increased. These in vivo experiments show that, otherFeat=[]-->, belongsTo=parr
360	the effects of the ventral protein CV2 are dependent on the levels of the dorsal protein Chordin,, otherFeat=[]-->, belongsTo=parr
361	and that CV2 can be either anti-BMP or pro-BMP. The hypersensitivity of CV2 morphants to, otherFeat=[]-->, belongsTo=parr
362	Chordin indicates that one of the functions of CV2 is to dampen the effects of Chordin. This, otherFeat=[]-->, belongsTo=parr
363	might be achieved, for example, by facilitating the removal and degradation of full-length, otherFeat=[]-->, belongsTo=parr
364	Chordin, its proteolytic fragments, or Chordin/BMP complexes after any or all of these factors, otherFeat=[]-->, belongsTo=parr
365	bind to CV2 on the cell membranes of the ventral side of the wild-type embryo. Since CV2 is, otherFeat=[]-->, belongsTo=parr
366	poorly diffusible (Rentzsch et al., 2006; Serpe et al., 2008), this anti-Chordin activity may act, otherFeat=[]-->, belongsTo=parr
367	in combination with tolloid proteinases to concentrate BMPs for peak signalling ventrally, otherFeat=[]-->, belongsTo=parr
368	(Figure 7)., otherFeat=[]-->, belongsTo=parr
369	DISCUSSION, otherFeat=[]-->, belongsTo=title
370	The function of CV2 presents an intriguing scientific mystery, because it has been found both, otherFeat=[]-->, belongsTo=parr
371	to increase (Conley et al., 2000; Rentzsch et al., 2006; Ikeya et al., 2006; Kamimura et al.,, otherFeat=[]-->, belongsTo=parr
372	2004; Coles et al., 2004) or to antagonize (Moser et al., 2003; Coles et al., 2004; Binnerts et, otherFeat=[]-->, belongsTo=parr
373	al., 2004; Zhang et al., 2007) BMP signaling according to the experimental setting. In this, otherFeat=[]-->, belongsTo=parr
374	study, we have used a combination of biochemical and Xenopus embryological assays in an, otherFeat=[]-->, belongsTo=parr
375	attempt to unravel this puzzle. We found that CV2/Tsg/BMP complexes act as BMP inhibitors, otherFeat=[]-->, belongsTo=parr
376	locally, and that the pro-BMP function of CV2 may result in part from its ability to bind Chordin, otherFeat=[]-->, belongsTo=parr
377	and Chordin/BMP complexes originating from more dorsal locations. In the presence of, otherFeat=[]-->, belongsTo=parr
378	tolloids, CV2 would serve to concentrate BMP signals ventrally., otherFeat=[]-->, belongsTo=parr
379	CV2 is a BMP4 Feedback Inhibitor, otherFeat=[]-->, belongsTo=parr
380	When CV2 was depleted in the Xenopus embryo, the early phenotype observed was one of, otherFeat=[]-->, belongsTo=parr
381	increased BMP signaling, indicating that a main function of CV2 is to serve as a BMP4, otherFeat=[]-->, belongsTo=parr
382	feedback inhibitor (Figure 1). Our results in Xenopus contrast with a previous report in, otherFeat=[]-->, belongsTo=parr
383	zebrafish that reached a different conclusion (Rentzsch et al., 2006). The finding that CV2, otherFeat=[]-->, belongsTo=parr
384	protein functions as an overall anti-BMP molecule in Xenopus is strongly supported by the fact, otherFeat=[]-->, belongsTo=parr
385	that CV2 and Chordin MOs cooperate with each other to ventralize the embryo (Figure 2). At, otherFeat=[]-->, belongsTo=parr
386	later stages of development, zebrafish anti-CV2 MO showed loss of the ventral fin (Rentzsch, otherFeat=[]-->, belongsTo=parr
387	et al., 2006;Moser et al., 2007) and, in agreement with this, we observed a similar phenotype, otherFeat=[]-->, belongsTo=parr
388	in Xenopus. The development of the ventral fin is thought to reflect the pro-BMP activity of, otherFeat=[]-->, belongsTo=parr
389	Chordin, which is transported together with BMP towards the ventral side (Little and Mullins,, otherFeat=[]-->, belongsTo=parr
390	2006). Thus, our data may suggest that the pro-BMP effects of CV2 are mediated by an, otherFeat=[]-->, belongsTo=parr
391	analogous flux of Chordin/BMP to the ventral side of the embryo., otherFeat=[]-->, belongsTo=parr
392	CV2 Concentrates Chordin/BMP, otherFeat=[]-->, belongsTo=parr
393	The principal biochemical finding reported here is that CV2 binds full-length Chordin with, otherFeat=[]-->, belongsTo=parr
394	high affinity. In Figure 7 we present a revised model for Xenopus D-V patterning based on our, otherFeat=[]-->, belongsTo=parr
395	biochemical and phenotypic results and on current thinking on how the crossveins are formed, otherFeat=[]-->, belongsTo=parr
396	in Drosophila (O'Connor et al., 2006;Blair, 2007). We propose that the pro-BMP effects of, otherFeat=[]-->, belongsTo=parr
397	CV2 are caused in part by of its action on Chordin/Tsg/BMP complexes diffusing to sites of, otherFeat=[]-->, belongsTo=parr
398	high 12CV2 expression in the ventral side of the embryo. On the dorsal side of the Xenopus, otherFeat=[]-->, belongsTo=parr
399	embryo, Chordin would predominantly bind ADMP (Anti-Dorsalizing Morphogenetic, otherFeat=[]-->, belongsTo=parr
400	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
401	Page 7, otherFeat=[]-->, belongsTo=nota_cab_pie
402	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
403	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
404	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
405	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
406	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
407	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
408	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
409	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
410	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
411	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
412	Protein), a BMP-like molecule that plays an important role in the self-regulation of D-V pattern, otherFeat=[]-->, belongsTo=parr
413	(Figure 7;Reversade and De Robertis, 2005). Tsg binds to both CV2 and Chordin, making them, otherFeat=[]-->, belongsTo=parr
414	better BMP antagonists, as well as to BMP4 (facilitating BMP4 signaling in the absence of, otherFeat=[]-->, belongsTo=parr
415	CV2 and Chordin) (Figure 7A). CV2 would provide localized binding sites for Chordin/BMP,, otherFeat=[]-->, belongsTo=parr
416	regulating the shape of the D-V patterning gradient. CV2 does not diffuse far from its site of, otherFeat=[]-->, belongsTo=parr
417	synthesis, due to a strong membrane/extracellular matrix heparin sulfate proteoglycan (HSPG), otherFeat=[]-->, belongsTo=parr
418	binding site in its vWFd domain (Rentzsch et al., 2006). In Drosophila, CV2 binds to the GPI, otherFeat=[]-->, belongsTo=parr
419	membrane-tethered HSPG Dally and is not able to signal beyond one or two cell diameters in, otherFeat=[]-->, belongsTo=parr
420	wing clones (Serpe et al., 2008). CV2 undergoes autocatalytic cleavage (Lidell et al., 2003), otherFeat=[]-->, belongsTo=parr
421	and is resistant to degradation by tolloids (Figure 2). However, Chordin and Chordin/BMP, otherFeat=[]-->, belongsTo=parr
422	complexes are readily cleaved by ventrally-expressed Xlr. Thus, binding of Chordin to CV2, otherFeat=[]-->, belongsTo=parr
423	would concentrate Chordin and its BMP complexes at the ventral center of the Xenopus embryo, otherFeat=[]-->, belongsTo=parr
424	(Figure 7A, flux indicated by red arrow)., otherFeat=[]-->, belongsTo=parr
425	Ventral Chordin/Tsg/BMP4 complexes would face two alternative fates. First, in the absence, otherFeat=[]-->, belongsTo=parr
426	of tolloids they would be inactivated and removed by CV2 binding. In this respect, it is, otherFeat=[]-->, belongsTo=parr
427	interesting to note that the binding of BMP/Chordin to CV2 is of higher affinity than that of, otherFeat=[]-->, belongsTo=parr
428	full-length Chordin alone, so this anti-BMP effect could be very efficient. Second, in the, otherFeat=[]-->, belongsTo=parr
429	presence of tolloid, complexes of Chordin with BMPs (perhaps pre-bound to CV2, see Figure, otherFeat=[]-->, belongsTo=parr
430	7B) would be cleaved, releasing active BMPs that would bind to BMPRs to achieve peak BMP, otherFeat=[]-->, belongsTo=parr
431	signaling ventrally (Piccolo et al., 1997; Reversade and De Robertis, 2005). CV2 has a high, otherFeat=[]-->, belongsTo=parr
432	affinity for the proteolytic fragments of Chordin digestion, and this could further facilitate BMP, otherFeat=[]-->, belongsTo=parr
433	signaling by retaining spent Chordin fragments and releasing BMP., otherFeat=[]-->, belongsTo=parr
434	This model of extracellular protein-protein interactions is supported by the phenotypic effects, otherFeat=[]-->, belongsTo=parr
435	of CV2 depletion in Xenopus. In wild type embryos, endogenous CV2 had an overall anti-BMP, otherFeat=[]-->, belongsTo=parr
436	function. However, CV2-depleted embryos became hypersensitive to the dorsalizing effects, otherFeat=[]-->, belongsTo=parr
437	of injected Chordin protein or DN-Xlr mRNA (Figure 6). This suggests that CV2 inhibits excess, otherFeat=[]-->, belongsTo=parr
438	Chordin in the embryo. Remarkably, Chordin overexpression or Xlr inhibition reversed the net, otherFeat=[]-->, belongsTo=parr
439	effect of CV2 knockdown, revealing a pro-BMP activity for endogenous CV2. This anti-, otherFeat=[]-->, belongsTo=parr
440	Chordin activity should remain localized to the ventral side of the embryo since CV2 is not, otherFeat=[]-->, belongsTo=parr
441	diffusible (Rentzsch et al., 2006;Serpe et al., 2008). By removing Chordin ventrally, CV2 could, otherFeat=[]-->, belongsTo=parr
442	facilitate BMP signaling. In addition, any BMP/Chordin complexes reaching the ventral side, otherFeat=[]-->, belongsTo=parr
443	can also signal, provided Xlr proteolytic activity is available. In conclusion, both embryological, otherFeat=[]-->, belongsTo=parr
444	and biochemical experiments suggest that interactions between CV2 and Chordin play a key, otherFeat=[]-->, belongsTo=parr
445	role in Xenopus D-V patterning., otherFeat=[]-->, belongsTo=parr
446	It should at this point be noted that while overexpressed Chordin clearly diffuses long-range, otherFeat=[]-->, belongsTo=parr
447	in Xenopus, and endogenous Sog has been shown to diffuse along the entire Drosophila, otherFeat=[]-->, belongsTo=parr
448	embryonic D-V axis (O'Connor et al., 2006), the range of action for endogenous Xenopus, otherFeat=[]-->, belongsTo=parr
449	Chordin protein remains the subject of active inquiry. If Chordin normally exerts its anti-BMP, otherFeat=[]-->, belongsTo=parr
450	effects over a relatively short range, the functional Chordin gradient observed in vivo may arise, otherFeat=[]-->, belongsTo=parr
451	from a "summation" of proteins secreted from different tissues, downstream of distinct, otherFeat=[]-->, belongsTo=parr
452	transcriptional controls (Blitz et al., 2000). Recently, diffusion of microinjected BMP4 from, otherFeat=[]-->, belongsTo=parr
453	the dorsal to the ventral side of the Xenopus gastrula has been directly visualized and shown, otherFeat=[]-->, belongsTo=parr
454	to require endogenous Chordin (Ben-Zvi et al., 2008). Regardless of the origin of the relevant, otherFeat=[]-->, belongsTo=parr
455	Chordin protein, our data demonstrate that CV2 coordinates both anti-BMP and pro-BMP, otherFeat=[]-->, belongsTo=parr
456	Chordin functions on the ventral side of the embryo., otherFeat=[]-->, belongsTo=parr
457	Comparison between Xenopus and Drosophila CV2, otherFeat=[]-->, belongsTo=parr
458	The proposed role of CV2 as a regulator of the flux of Chordin/BMP complexes (Figure 7), otherFeat=[]-->, belongsTo=parr
459	may explain only part of its pro-BMP effects. A recent study in Drosophila has shown that, otherFeat=[]-->, belongsTo=parr
460	CV2 binds specifically to the BMP type I receptor Thickveins (Tkv), suggesting that CV2 may, otherFeat=[]-->, belongsTo=parr
461	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
462	Page 8, otherFeat=[]-->, belongsTo=nota_cab_pie
463	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
464	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
465	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
466	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
467	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
468	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
469	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
470	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
471	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
472	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
473	promote BMP signaling by facilitating transfer to BMPR (Serpe et al., 2008). We have been, otherFeat=[]-->, belongsTo=parr
474	able to confirm this binding for vertebrate proteins, using commercial BMPR-1a (ALK-3) and, otherFeat=[]-->, belongsTo=parr
475	CV2 mouse proteins (unpublished observations). A mathematical model was proposed to, otherFeat=[]-->, belongsTo=parr
476	explain how high levels of CV2 would inhibit BMP signaling and lower levels could enhance, otherFeat=[]-->, belongsTo=parr
477	signalling (Serpe et al., 2008). Our finding that Chordin/BMP complexes bind avidly to CV2, otherFeat=[]-->, belongsTo=parr
478	complements and enriches this model. In the Drosophila wing, Sog/Tsg2/Dpp complexes, otherFeat=[]-->, belongsTo=parr
479	diffuse long-range from the longitudinal veins to the crossveins, where Dpp is released by, otherFeat=[]-->, belongsTo=parr
480	Tolloid-related (Ralston and Blair, 2005;Blair, 2007). The crossveins are sites of peak BMP, otherFeat=[]-->, belongsTo=parr
481	signaling. CV2 protein remains tethered to its site of synthesis in crossveins (Serpe et al.,, otherFeat=[]-->, belongsTo=parr
482	2008), and could serve to concentrate diffusible Sog/Tsg2/Dpp complexes. An interesting, otherFeat=[]-->, belongsTo=parr
483	possibility is that the cleavage of Chordin or Sog by tolloids might take place on Chordin/Tsg/, otherFeat=[]-->, belongsTo=parr
484	BMP already bound to CV2 (Figure 7B). Since we have observed that mouse CV2 associates, otherFeat=[]-->, belongsTo=parr
485	with BMPR-1a in vitro, this interaction might also facilitate BMPR signaling in vertebrates., otherFeat=[]-->, belongsTo=parr
486	The Chordin digestion products, which have an even higher affinity for CV2 than full-length, otherFeat=[]-->, belongsTo=parr
487	Chordin (Figure 5D), would remain attached to CV2 and be removed, perhaps by endocytosis., otherFeat=[]-->, belongsTo=parr
488	This extracellular machinery would ensure that peak BMP signaling is achieved in the ventral, otherFeat=[]-->, belongsTo=parr
489	center., otherFeat=[]-->, belongsTo=parr
490	In conclusion, the finding that CV2 binds to Chordin will help develop mechanistic models, otherFeat=[]-->, belongsTo=parr
491	for the diverse CV2 activities described in the literature. The important discovery by Serpe et, otherFeat=[]-->, belongsTo=parr
492	al. (2008) that CV2 also binds to Tkv greatly increases the regulatory possibilities of this, otherFeat=[]-->, belongsTo=parr
493	system. The biochemical pathway involving Chordin, BMP, Tsg, Tolloid and CV2 proteins, otherFeat=[]-->, belongsTo=parr
494	has revealed a new paradigm for the exquisite extracellular regulation of embryonic cell, otherFeat=[]-->, belongsTo=parr
495	differentiation. This pathway is ancestral to D-V patterning of all bilateral animals, since the, otherFeat=[]-->, belongsTo=parr
496	entire system has been conserved during evolution (De Robertis, 2008)., otherFeat=[]-->, belongsTo=parr
497	MATERIALS AND METHODS, otherFeat=['U']-->, belongsTo=title
498	Morpholino Oligomers, mRNA and Protein Injections, otherFeat=[]-->, belongsTo=parr
499	Morpholino antisense oligomers (MO) were obtained from Gene Tools. The CV2 MO used in, otherFeat=[]-->, belongsTo=parr
500	most of this study had the sequence 5-TGCCAGTGGAGAAGCAGCTGTGCAT-3. CV2, otherFeat=[]-->, belongsTo=parr
501	MO1 and CV2 MO2, used as additional specificity controls, target the CV2 mRNA 5UTR and, otherFeat=[]-->, belongsTo=parr
502	had the sequences 5-TATAGCATCCAGACTGTTGCAGGTT-3 and 5-, otherFeat=[]-->, belongsTo=parr
503	TTAGAGTGAGGAGTCAAGAACAGAG-3 respectively. Other MOs were as described:, otherFeat=[]-->, belongsTo=parr
504	Chordin MO (Oelgeschl?ger et al., 2003), Tsg MO (Blitz et al., 2003), and BMP4 MO, otherFeat=[]-->, belongsTo=parr
505	(Reversade and De Robertis, 2005). Each MO was microinjected (500 M or 250 M, 4 nL), otherFeat=[]-->, belongsTo=parr
506	four times radially into 2- or 4-cell embryos. For mRNA injections, a full-length Xenopus CV2, otherFeat=[]-->, belongsTo=parr
507	EST clone (#XL039c09) was used as a template for PCR. 5 and 3 untranslated regions were, otherFeat=[]-->, belongsTo=parr
508	deleted, a Flag-tagged signal peptide (Piccolo et al., 1997) was added, and cloned into pCS2, otherFeat=[]-->, belongsTo=parr
509	to generate FL-CV2, Nter-CV2 and Cter-CV2. Synthetic mRNAs were prepared by linearizing, otherFeat=[]-->, belongsTo=parr
510	with NotI, transcribed with SP6 polymerase, and 500 pg injected. The three mRNAs produced, otherFeat=[]-->, belongsTo=parr
511	Flag-tagged proteins of the expected size in microinjected embryos (data not shown)., otherFeat=[]-->, belongsTo=parr
512	Recombinant mouse CV2 or Tsg proteins (R&D Systems) were microinjected (5 M, 40 nL), otherFeat=[]-->, belongsTo=parr
513	into the blastocoele at late blastula stage (stage 9.5). The most effective dose of Chordin protein, otherFeat=[]-->, belongsTo=parr
514	for injections was 60 nL at 2 M. Procedures for whole-mount in situ hybridization are available, otherFeat=[]-->, belongsTo=parr
515	at  www.hhmi.ucla.edu/derobertis/index.html., otherFeat=[]-->, belongsTo=parr
516	Biochemical Methods, otherFeat=[]-->, belongsTo=parr
517	Recombinant mouse CV2, mouse Tsg, mouse Chordin and human BMP4 were purchased from, otherFeat=[]-->, belongsTo=parr
518	R&D Systems, and Xenopus Chordin-Myc was produced in baculovirus (Piccolo et al.,, otherFeat=[]-->, belongsTo=parr
519	1996). Phospho-Smad1 was detected in whole embryos using anti-phospho-Smad1/Smad5/, otherFeat=[]-->, belongsTo=parr
520	Smad8 antibody (1:1000, Cell Signaling Technology) and anti-total Smad1 (1:1000, Zymed), otherFeat=[]-->, belongsTo=parr
521	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
522	Page 9, otherFeat=[]-->, belongsTo=nota_cab_pie
523	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
524	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
525	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
526	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
527	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
528	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
529	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
530	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
531	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
532	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
533	as loading control. Protein extracts were made from at least 10 embryos for each sample. For, otherFeat=[]-->, belongsTo=parr
534	in vitro digestions, 30 nM Chordin-Myc or 50 nM recombinant mouse CV2 were incubated in, otherFeat=[]-->, belongsTo=parr
535	Xld buffer (Piccolo et al., 1997) with 2 nM affinity-purified Xlr-Flag (Lee et al., 2006) or with, otherFeat=[]-->, belongsTo=parr
536	293T cells xBMP1-transfected conditioned medium at 25?C for 18 h. Goat anti-mouse CV2, otherFeat=[]-->, belongsTo=parr
537	antibody (R&D Systems) was diluted 1:2000 for Western blots., otherFeat=[]-->, belongsTo=parr
538	For in vitro autocatalytic cleavage, 50 nM recombinant mouse CV2 was incubated at 37?C in, otherFeat=[]-->, belongsTo=parr
539	citric acid-Na2HPO4 (McIlvaine buffer) at varying pH for 18 h. For crosslinking, the indicated, otherFeat=[]-->, belongsTo=parr
540	proteins were incubated in PBS for at least 1 h at room temperature. Disuccinimidyl suberate, otherFeat=[]-->, belongsTo=parr
541	(DSS, Pierce) was added to a final concentration of 1 mM, incubated with agitation for 45 min, otherFeat=[]-->, belongsTo=parr
542	at room temperature, and the reaction stopped by adding Tris-HCl (pH 8) to a final, otherFeat=[]-->, belongsTo=parr
543	concentration of 50 mM. Samples were directly separated on SDS gels under reducing, otherFeat=[]-->, belongsTo=parr
544	conditions. For co-immunoprecipitation, the indicated proteins were incubated overnight at 4?, otherFeat=[]-->, belongsTo=parr
545	C in TS buffer (20 mM Tris pH 7.5; 150 mM NaCl; 1.5 mM CaCl2; 1.5 mM MgCl2)., otherFeat=[]-->, belongsTo=parrnote
546	Anti-mouse CV2 antibody (R&D systems) was bound to protein G agarose (Pierce) and 20l, otherFeat=[]-->, belongsTo=parr
547	of beads added to each reaction. In some cases, CV2 was pre-bound to CV2 antibody beads, otherFeat=[]-->, belongsTo=parr
548	and washed prior to incubation with the other proteins. For the binding of Chordin fragments, otherFeat=[]-->, belongsTo=parr
549	to CV2, 25 nM Chordin-Myc was incubated with 2 nM purified Xlr-PC (Lee et al., 2006) for, otherFeat=[]-->, belongsTo=parr
550	15 min or 2 h at 25?C. Metalloproteinase reactions were stopped by addition of 1 mM of the, otherFeat=[]-->, belongsTo=parr
551	zinc chelator 1?10 orthophenanthroline on ice. All biochemical experiments were repeated at, otherFeat=[]-->, belongsTo=parr
552	least two times., otherFeat=[]-->, belongsTo=parr
553	For BMP receptor binding assays, recombinant mouse CV2, mouse Tsg, and human BMP4, otherFeat=[]-->, belongsTo=parr
554	were preincubated at room temperature for 1 h, and BMPR IB-Fc protein (R&D Systems) was, otherFeat=[]-->, belongsTo=parr
555	added for an additional hour. BMP bound to the BMPR was detected by anti-BMP4 Western, otherFeat=[]-->, belongsTo=parr
556	blot after protein A precipitation of the receptor (Larra?n et al., 2001)., otherFeat=[]-->, belongsTo=parr
557	For quantitative RT-PCR (qRT-PCR), total RNA was extracted from pools of five embryos, otherFeat=[]-->, belongsTo=parr
558	with Absolute RNA MicroPrep Kit, reverse transcribed, and analyzed in a MX3000P apparatus, otherFeat=[]-->, belongsTo=parr
559	using Brilliant SYBR GREEN QPCR Master Mix (Stratagene)., otherFeat=[]-->, belongsTo=parr
560	Surface Plasmon Resonance (SPR) Analyses, otherFeat=[]-->, belongsTo=parr
561	SPR measurements were performed on a Biacore 3000 system. Recombinant Chordin was, otherFeat=[]-->, belongsTo=parr
562	dissolved at 10 g/ml in 10 mM sodium acetate (pH 5.0) and immobilized on a CM5 (carboxy, otherFeat=[]-->, belongsTo=parr
563	methylcellulose) sensor chip using the amine coupling method to a level of about 2500 response, otherFeat=[]-->, belongsTo=parr
564	units. Binding and washes were performed in PBS using recombinant mouse CV2 protein, otherFeat=[]-->, belongsTo=parr
565	dissolved in the same buffer. Each experimental cycle consisted of a flow of commercial CV2, otherFeat=[]-->, belongsTo=parr
566	at indicated concentrations followed by washes with buffer alone. After each cycle, chip, otherFeat=[]-->, belongsTo=parr
567	surfaces were regenerated by removing non-crosslinked proteins with 10 mM HCl. Data were, otherFeat=[]-->, belongsTo=parr
568	analyzed with BIAevaluation 4.1 software and curve-fitting was done with the assumption of, otherFeat=[]-->, belongsTo=parr
569	one-to-one binding (Wang et al., 2003)., otherFeat=[]-->, belongsTo=parr
570	Supplementary Material, otherFeat=[]-->, belongsTo=title
571	Refer to Web version on PubMed Central for supplementary material., otherFeat=[]-->, belongsTo=parrnote
572	Acknowledgments, otherFeat=[]-->, belongsTo=title
573	We thank members of our laboratory for comments on the manuscript, N. Ketpura, A. Mays and C. Zer for help with, otherFeat=[]-->, belongsTo=parrnote
574	preliminary studies, and Drs. M. O'Connor and S. Blair for sharing results before publication. D. Geissert and T. Boe, otherFeat=[]-->, belongsTo=parrnote
575	provided expert technical assistance. V.F.T. thanks Drs. C. Wylie and J. Heasman for help with the oocyte CV2, otherFeat=[]-->, belongsTo=parrnote
576	depletion experiment carried out at the Cold Spring Harbor Xenopus Embryology course. We are grateful to the UCLA, otherFeat=[]-->, belongsTo=parrnote
577	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
578	Page 10, otherFeat=[]-->, belongsTo=nota_cab_pie
579	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
580	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
581	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
582	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
583	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
584	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
585	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
586	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
587	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
588	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
589	core facility led by Dr. R. Lehrer for help with the Biacore analyses. This work was supported by NIH grant, otherFeat=[]-->, belongsTo=parrnote
590	HD21502-22. E.M.D.R is an investigator of the Howard Hughes Medical Institute., otherFeat=[]-->, belongsTo=parrnote
591	References, otherFeat=[]-->, belongsTo=title
592	Ben-Zvi D, Shilo BZ, Fainsod A, Barkai N. Scaling of the BMP activation gradient in Xenopus embryos., otherFeat=[]-->, belongsTo=parrnote
593	Nature. 2008in press, otherFeat=[]-->, belongsTo=parrnote
594	Binnerts ME, Wen X, Cante-Barrett K, Bright J, Chen HT, Asundi V, Sattari P, Tang T, Boyle B, Funk, otherFeat=[]-->, belongsTo=parrnote
595	W, Rupp F. Human Crossveinless-2 is a novel inhibitor of bone morphogenetic proteins. Biochem, otherFeat=[]-->, belongsTo=parrnote
596	Biophys Res Commun 2004;315:272?280. [PubMed: 14766204], otherFeat=[]-->, belongsTo=parrnote
597	Blair SS. Wing vein patterning in Drosophila and the analysis of intercellular signaling. Annu Rev Cell, otherFeat=[]-->, belongsTo=parrnote
598	Dev Biol 2007;23:293?319. [PubMed: 17506700], otherFeat=[]-->, belongsTo=parrnote
599	Blitz IL, Chow KW, Chang C. Twisted gastrulation loss-of-function analyses support its role as a BMP, otherFeat=[]-->, belongsTo=parrnote
600	inhibitor during early Xenopus embryogenesis. Development 2003;130:4975?4988. [PubMed:, otherFeat=[]-->, belongsTo=parrnote
601	12952901], otherFeat=[]-->, belongsTo=parrnote
602	Blitz IL, Shimmi O, W?nnenberg-Stapleton K, O'Connor MB, Cho KW. Is chordin a long-range- or, otherFeat=[]-->, belongsTo=parrnote
603	short-range-acting factor? Roles for BMP1-related metalloproteases in chordin and BMP4, otherFeat=[]-->, belongsTo=parrnote
604	autofeedback loop regulation. Dev Biol 2000;223:120?138. [PubMed: 10864466], otherFeat=[]-->, belongsTo=parrnote
605	Coffinier C, Ketpura N, Tran U, Geissert D, De Robertis EM. Mouse Crossveinless-2 is the vertebrate, otherFeat=[]-->, belongsTo=parrnote
606	homolog of a Drosophila extracellular regulator of BMP signaling. Mech Dev 2002;119:179?184., otherFeat=[]-->, belongsTo=parrnote
607	Coles E, Christiansen J, Economou A, Bronner-Fraser M, Wilkinson DG. A vertebrate crossveinless 2, otherFeat=[]-->, belongsTo=parrnote
608	homologue modulates BMP activity and neural crest cell migration. Development 2004;131:5309?, otherFeat=[]-->, belongsTo=parrnote
609	5317. [PubMed: 15456729], otherFeat=[]-->, belongsTo=parrnote
610	Conley CA, Silburn R, Singer MA, Ralston A, Rohwer-Nutter D, Olson DJ, Gelbart W, Blair SS., otherFeat=[]-->, belongsTo=parrnote
611	Crossveinless 2 contains cysteine-rich domains and is required for high levels of BMP-like activity, otherFeat=[]-->, belongsTo=parrnote
612	during the formation of the cross veins in Drosophila. Development 2000;127:3947?3959. [PubMed:, otherFeat=[]-->, belongsTo=parrnote
613	10952893], otherFeat=[]-->, belongsTo=parrnote
614	Dale L, Evans W, Goodman SA. Xolloid-related: a novel BMP1/Tolloid-related metalloprotease is, otherFeat=[]-->, belongsTo=parrnote
615	expressed during early Xenopus development. Mech Dev 2002;119:177?190. [PubMed: 12464431], otherFeat=[]-->, belongsTo=parrnote
616	De Robertis EM. Spemann's organizer and self-regulation in amphibian embryos. Nat Rev Mol Cell Biol, otherFeat=[]-->, belongsTo=parrnote
617	2006;7:296?302. [PubMed: 16482093], otherFeat=[]-->, belongsTo=parrnote
618	De Robertis EM. Evo-devo: variations on ancestral themes. Cell 2008;132:185?195. [PubMed:, otherFeat=[]-->, belongsTo=parrnote
619	18243095], otherFeat=[]-->, belongsTo=parrnote
620	Ikeya M, Kawada M, Kiyonari H, Sasai N, Nakao K, Furuta Y, Sasai Y. Essential pro-Bmp roles of, otherFeat=[]-->, belongsTo=parrnote
621	crossveinless 2 in mouse organogenesis. Development 2006;133:4463?4473. [PubMed: 17035289], otherFeat=[]-->, belongsTo=parrnote
622	Kamimura M, Matsumoto K, Koshiba-Takeuchi K, Ogura T. Vertebrate crossveinless 2 is secreted and, otherFeat=[]-->, belongsTo=parrnote
623	acts as an extracellular modulator of the BMP signaling cascade. Dev Dyn 2004;230:434?445., otherFeat=[]-->, belongsTo=parrnote
624	[PubMed: 15188429], otherFeat=[]-->, belongsTo=parrnote
625	Larra?n J, Oelgeschl?ger M, Ketpura NI, Reversade B, Zakin L, De Robertis EM. Proteolytic cleavage, otherFeat=[]-->, belongsTo=parrnote
626	of Chordin as a switch for the dual activities of Twisted gastrulation in BMP signaling. Development, otherFeat=[]-->, belongsTo=parrnote
627	2001;128:4439?4447. [PubMed: 11714670], otherFeat=[]-->, belongsTo=parrnote
628	Lee HX, Ambrosio AL, Reversade B, De Robertis EM. Embryonic dorsal-ventral signaling: secreted, otherFeat=[]-->, belongsTo=parrnote
629	Frizzled-related Proteins as inhibitors of Tolloid proteinases. Cell 2006;124:147?159. [PubMed:, otherFeat=[]-->, belongsTo=parrnote
630	16413488], otherFeat=[]-->, belongsTo=parrnote
631	Lidell ME, Johansson ME, Hansson GC. An autocatalytic cleavage in the C terminus of the human MUC2, otherFeat=[]-->, belongsTo=parrnote
632	mucin occurs at the low pH of the late secretory pathway. J Biol Chem 2003;278:13944?13951., otherFeat=[]-->, belongsTo=parrnote
633	[PubMed: 12582180], otherFeat=[]-->, belongsTo=parrnote
634	Little SC, Mullins MC. Twisted gastrulation promotes BMP signaling in zebrafish dorsal-ventral axial, otherFeat=[]-->, belongsTo=parrnote
635	patterning. Development 2004;131:5825?5835. [PubMed: 15525664], otherFeat=[]-->, belongsTo=parrnote
636	Little SC, Mullins MC. Extracellular modulation of BMP activity in patterning the dorsoventral axis., otherFeat=[]-->, belongsTo=parrnote
637	Birth Defects Res C Embryo Today 2006;78:224?242. [PubMed: 17061292], otherFeat=[]-->, belongsTo=parrnote
638	Moser M, Binder O, Wu Y, Aitsebaomo J, Ren R, Bode C, Bautch VL, Conlon FL, Patterson C. BMPER,, otherFeat=[]-->, belongsTo=parrnote
639	a novel endothelial cell precursor-derived protein, antagonizes bone morphogenetic protein signaling, otherFeat=[]-->, belongsTo=parrnote
640	and endothelial cell differentiation. Mol Cell Biol 2003;23:5664?5679. [PubMed: 12897139], otherFeat=[]-->, belongsTo=parrnote
641	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
642	Page 11, otherFeat=[]-->, belongsTo=nota_cab_pie
643	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
644	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
645	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
646	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
647	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
648	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
649	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
650	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
651	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
652	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
653	Moser M, Yu Q, Bode C, Xiong JW, Patterson C. BMPER is a conserved regulator of hematopoietic and, otherFeat=[]-->, belongsTo=parrnote
654	vascular development in zebrafish. J Mol Cell Cardiol 2007;43:243?253. [PubMed: 17618647], otherFeat=[]-->, belongsTo=parrnote
655	O'Connor MB, Umulis D, Othmer HG, Blair SS. Shaping BMP morphogen gradients in the Drosophila, otherFeat=[]-->, belongsTo=parrnote
656	embryo and pupal wing. Development 2006;33:183?193., otherFeat=[]-->, belongsTo=parrnote
657	Oelgeschl?ger M, Larra?n J, Geissert D, De Robertis EM. The evolutionarily conserved BMP-binding, otherFeat=[]-->, belongsTo=parrnote
658	protein Twisted gastrulation promotes BMP signalling. Nature 2000;405:757?763. [PubMed:, otherFeat=[]-->, belongsTo=parrnote
659	10866189], otherFeat=[]-->, belongsTo=parrnote
660	Oelgeschl?ger M, Kuroda H, Reversade B, De Robertis EM. Chordin is required for the Spemann, otherFeat=[]-->, belongsTo=parrnote
661	organizer transplantation phenomenon in Xenopus embryos. Dev Cell 2003;4:219?230. [PubMed:, otherFeat=[]-->, belongsTo=parrnote
662	12586065], otherFeat=[]-->, belongsTo=parrnote
663	Piccolo S, Sasai Y, Lu B, De Robertis EM. Dorsoventral patterning in Xenopus: Inhibition of ventral, otherFeat=[]-->, belongsTo=parrnote
664	signals by direct binding of Chordin to BMP-4. Cell 1996;86:589?598. [PubMed: 8752213], otherFeat=[]-->, belongsTo=parrnote
665	Piccolo S, Agius E, Lu B, Goodman S, Dale L, De Robertis EM. Cleavage of Chordin by the Xolloid, otherFeat=[]-->, belongsTo=parrnote
666	metalloprotease suggests a role for proteolytic processing in the regulation of Spemann organizer, otherFeat=[]-->, belongsTo=parrnote
667	activity. Cell 1997;91:407?416. [PubMed: 9363949], otherFeat=[]-->, belongsTo=parrnote
668	Ralston A, Blair SS. Long-range Dpp signaling is regulated to restrict BMP signaling to a crossvein, otherFeat=[]-->, belongsTo=parrnote
669	competent zone. Dev Biol 2005;280:187?200. [PubMed: 15766758], otherFeat=[]-->, belongsTo=parrnote
670	Rentzsch F, Zhang J, Kramer C, Sebald W, Hammerschmidt M. Crossveinless 2 is an essential positive, otherFeat=[]-->, belongsTo=parrnote
671	feedback regulator of Bmp signaling during zebrafish gastrulation. Development 2006;133:801?811., otherFeat=[]-->, belongsTo=parrnote
672	[PubMed: 16439480], otherFeat=[]-->, belongsTo=parrnote
673	Reversade B, De Robertis EM. Regulation of ADMP and BMP2/4/7 at opposite embryonic poles, otherFeat=[]-->, belongsTo=parrnote
674	generates a self-regulating morphogenetic field. Cell 2005;123:1147?1160. [PubMed: 16360041], otherFeat=[]-->, belongsTo=parrnote
675	Ross JJ, Shimmi O, Vilmos P, Petryk A, Kim H, Gaudenz K, Hermanson S, Ekker SC, O'Connor MB,, otherFeat=[]-->, belongsTo=parrnote
676	Marsh JL. Twisted gastrulation is a conserved extracellular BMP antagonist. Nature 2001;410:479?, otherFeat=[]-->, belongsTo=parrnote
677	483. [PubMed: 11260716], otherFeat=[]-->, belongsTo=parrnote
678	Sasai Y, Lu B, Steinbeisser H, De Robertis EM. Regulation of neural induction by the Chd and Bmp-4, otherFeat=[]-->, belongsTo=parrnote
679	antagonistic patterning signals in Xenopus. Nature 1995;376:333?336. [PubMed: 7630399], otherFeat=[]-->, belongsTo=parrnote
680	Serpe M, Umulis D, Ralston A, Chen J, Olson DJ, Othmer H, O'Connor MB, Blair SS. The cell-tethered, otherFeat=[]-->, belongsTo=parrnote
681	BMP binding protein Crossveinless 2 is a short-range co-receptor that promotes or inhibits BMP, otherFeat=[]-->, belongsTo=parrnote
682	signaling in a concentration dependant manner. Dev Cell 2008;14:940?953. [PubMed: 18539121], otherFeat=[]-->, belongsTo=parrnote
683	Shimmi O, Ralston A, Blair SS, O'Connor MB. The crossveinless gene encodes a new member of the, otherFeat=[]-->, belongsTo=parrnote
684	Twisted gastrulation family of BMP-binding proteins which, with Short gastrulation, promotes BMP, otherFeat=[]-->, belongsTo=parrnote
685	signaling in the crossveins of the Drosophila wing. Dev Biol 2005;282:70?83. [PubMed: 15936330], otherFeat=[]-->, belongsTo=parrnote
686	Vilmos P, Sousa-Neves R, Lukacsovich T, Marsh JL. Crossveinless defines a new family of Twisted-, otherFeat=[]-->, belongsTo=parrnote
687	gastrulation-like modulators of bone morphogenetic protein signalling. EMBO Rep 2005;6:262?267., otherFeat=[]-->, belongsTo=parrnote
688	[PubMed: 15711536], otherFeat=[]-->, belongsTo=parrnote
689	Wang W, Cole AM, Hong T, Waring AJ, Lehrer RI. Retrocyclin, an antiretroviral theta-defensin, is a, otherFeat=[]-->, belongsTo=parrnote
690	lectin. J Immunol 2003;170:4708?4716. [PubMed: 12707350], otherFeat=[]-->, belongsTo=parrnote
691	Xie J, Fisher S. Twisted gastrulation enhances BMP signaling through chordin dependent and independent, otherFeat=[]-->, belongsTo=parrnote
692	mechanisms. Development 2005;132:383?391. [PubMed: 15604098], otherFeat=[]-->, belongsTo=parrnote
693	Zhang JL, Huang Y, Qiu LY, Nickel J, Sebald W. von Willebrand factor type C domain-containing, otherFeat=[]-->, belongsTo=parrnote
694	proteins regulate bone morphogenetic protein signaling through different recognition mechanisms., otherFeat=[]-->, belongsTo=parrnote
695	J Biol Chem 2007;282:20002?20014. [PubMed: 17483092], otherFeat=[]-->, belongsTo=parrnote
696	Zhang JL, Qiu LY, Kotzsch A, Weidauer S, Patterson L, Hammerschmidt M, Sebald W, Mueller TD., otherFeat=[]-->, belongsTo=parrnote
697	Crystal structure Analysis Reveals How the Chordin Family Member Crossveinless 2 Blocks BMP-2, otherFeat=[]-->, belongsTo=parrnote
698	Receptor Binding. Dev Cell 2008;14:739?750. [PubMed: 18477456], otherFeat=[]-->, belongsTo=parrnote
699	Zimmerman LB, De Jesus-Escobar JM, Harland RM. The Spemann organizer signal noggin binds and, otherFeat=[]-->, belongsTo=parrnote
700	inactivates bone morphogenetic protein 4. Cell 1996;86:599?606. [PubMed: 8752214], otherFeat=[]-->, belongsTo=parrnote
701	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
702	Page 12, otherFeat=[]-->, belongsTo=nota_cab_pie
703	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
704	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
705	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
706	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
707	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
708	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
709	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
710	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
711	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
712	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
713	Figure 1. CV2 is a Secreted BMP Feedback Inhibitor, otherFeat=[]-->, belongsTo=fig_caption
714	(A) Normal CV2 expression at stage 22 (hemisection). vb, ventral blastopore, otherFeat=[]-->, belongsTo=fig_caption
715	(B) CV2MO microinjection increases CV2 expression., otherFeat=[]-->, belongsTo=fig_caption
716	(C) The CV2 negative feedback loop requires BMP4. For each experimental sample at least, otherFeat=[]-->, belongsTo=fig_caption
717	25 embryos were examined, with similar results., otherFeat=[]-->, belongsTo=fig_caption
718	(D) qRT-PCR showing increased expression of the ventral marker Vent1 in CV2-depleted, otherFeat=[]-->, belongsTo=fig_caption
719	embryos., otherFeat=[]-->, belongsTo=fig_caption
720	(E) CV2 depletion reduces expression of the dorsal/forebrain marker Six3., otherFeat=[]-->, belongsTo=fig_caption
721	(F) Endogenous Smad1 phosphorylation is increased by CV2 depletion at gastrula and neurula, otherFeat=[]-->, belongsTo=fig_caption
722	stages 12, 13 and 14. A pSmad1 signal was detectable in the stage 14 uninjected lane upon, otherFeat=[]-->, belongsTo=fig_caption
723	longer exposure. Total Smad1 antibody (T-Smad1) staining was used as loading control., otherFeat=[]-->, belongsTo=fig_caption
724	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
725	Page 13, otherFeat=[]-->, belongsTo=nota_cab_pie
726	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
727	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
728	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
729	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
730	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
731	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
732	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
733	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
734	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
735	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
736	Figure 2. CV2 and Chordin Compensate for Each Other in Xenopus D-V Patterning, otherFeat=[]-->, belongsTo=fig_caption
737	(A) Uninjected embryo showing CV2 expression, which is used here as a BMP4 signaling, otherFeat=[]-->, belongsTo=fig_caption
738	readout (n=17). Inset shows mid-gastrula embryo stained for Chordin (Chd) and Sizzled (Szl), otherFeat=[]-->, belongsTo=fig_caption
739	(n=24)., otherFeat=[]-->, belongsTo=fig_caption
740	(B) CV2 depletion upregulates its own expression (n=15), as well as increasing Szl and, otherFeat=[]-->, belongsTo=fig_caption
741	decreasing Chd (n=20)., otherFeat=[]-->, belongsTo=fig_caption
742	(C) Depletion of the BMP antagonist Chordin also increases the ventral CV2 and Szl expression, otherFeat=[]-->, belongsTo=fig_caption
743	domains (n=13 and n=18, respectively)., otherFeat=[]-->, belongsTo=fig_caption
744	(D) When co-injected, CV2 MO and Chd MO show a marked expansion of the CV2 and Szl, otherFeat=[]-->, belongsTo=fig_caption
745	expression domains (n=15 and n=25, respectively)., otherFeat=[]-->, belongsTo=fig_caption
746	(E?H) qRT-PCR analyses of single and double CV2 and Chd morphants for the D-V markers, otherFeat=[]-->, belongsTo=fig_caption
747	Szl, CV2, Gsc and Chd at late gastrula stage 12.5., otherFeat=[]-->, belongsTo=fig_caption
748	(I) Endogenous Smad1 phosphorylation is increased by co-injection of Chd MO and CV2 MO, otherFeat=[]-->, belongsTo=fig_caption
749	in stage 11 embryos., otherFeat=[]-->, belongsTo=fig_caption
750	(J) The CV2 cleavage sequence contains the conserved low-pH GDPH autocatalytic site, otherFeat=[]-->, belongsTo=fig_caption
751	present in mucins. hMuc2, human mucin-2., otherFeat=[]-->, belongsTo=fig_caption
752	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
753	Page 14, otherFeat=[]-->, belongsTo=nota_cab_pie
754	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
755	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
756	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
757	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
758	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
759	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
760	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
761	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
762	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
763	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
764	(K) Chordin, but not full-length CV2, is cleaved by the extracellular zinc-metalloproteinases, otherFeat=[]-->, belongsTo=parr
765	Xolloid-related (Xlr) and BMP1 (lanes 1?6). However, cleavage of full-length CV2 (80 kD, otherFeat=[]-->, belongsTo=parr
766	band) is triggered by low pH (lanes 9 and 10)., otherFeat=[]-->, belongsTo=parr
767	(L?N) Ventral injections of mRNAs encoding full-length CV2 (CV2-FL, n=56, of which 95%, otherFeat=[]-->, belongsTo=parr
768	had partial secondary axes, three independent experiments), N-terminal CV2 fragment, otherFeat=[]-->, belongsTo=parr
769	terminating at the GDPH cleavage site (CV2 N-Ter, n=42, no secondary axes observed), or a, otherFeat=[]-->, belongsTo=parr
770	secreted C-terminal fragment encoding most of the vWFd domain (CV2 C-Ter, n=45, no, otherFeat=[]-->, belongsTo=parr
771	secondary axes observed). The insets show injected embryos at late neurula stage hybridized, otherFeat=[]-->, belongsTo=parr
772	with the pan-neural marker Sox2., otherFeat=[]-->, belongsTo=parr
773	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
774	Page 15, otherFeat=[]-->, belongsTo=nota_cab_pie
775	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
776	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
777	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
778	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
779	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
780	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
781	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
782	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
783	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
784	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
785	Figure 3. Twisted-Gastrulation (Tsg) is Required for the Effects of CV2 Loss-of-Function and, otherFeat=[]-->, belongsTo=fig_caption
786	Overexpression, otherFeat=[]-->, belongsTo=fig_caption
787	(A) Simultaneous depletion of CV2 and Chordin strikingly increased CV2 expression,, otherFeat=[]-->, belongsTo=fig_caption
788	reflecting increased BMP signaling (see Figure S5 for controls)., otherFeat=[]-->, belongsTo=fig_caption
789	(B) The effects of CV2 MO and Chd MO require Tsg activity (pro-BMP effect of Tsg)., otherFeat=[]-->, belongsTo=fig_caption
790	(C) CV2 protein injection into the blastula cavity induces strong dorsalization of the, otherFeat=[]-->, belongsTo=fig_caption
791	Xenopus embryo, as indicated by the expansion of the dorsal markers Xag1, Six3, and, otherFeat=[]-->, belongsTo=fig_caption
792	Krox20 (n=12, all strongly dorsalized). Inset shows an uninjected embryo., otherFeat=[]-->, belongsTo=fig_caption
793	(D) CV2 protein requires endogenous Tsg for its anti-BMP activity (n=10, all embryos, otherFeat=[]-->, belongsTo=fig_caption
794	similarly affected). Inset shows Tsg MO injected embryo., otherFeat=[]-->, belongsTo=fig_caption
795	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
796	Page 16, otherFeat=[]-->, belongsTo=nota_cab_pie
797	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
798	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
799	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
800	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
801	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
802	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
803	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
804	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
805	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
806	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
807	(E) CV2 protein injection expands the neural tube (n=17). Inset shows uninjected embryo., otherFeat=[]-->, belongsTo=parr
808	(F) Tsg and CV2 protein co-injection renders CV2 a stronger BMP antagonist, expanding the, otherFeat=[]-->, belongsTo=parr
809	nervous system marked by Sox3 (n=16, all co-injected embryos were more dorsalized than, otherFeat=[]-->, belongsTo=parr
810	those injected with CV2 protein alone despite some individual variations). Inset shows embryo, otherFeat=[]-->, belongsTo=parr
811	injected with Tsg protein alone., otherFeat=[]-->, belongsTo=parr
812	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
813	Page 17, otherFeat=[]-->, belongsTo=nota_cab_pie
814	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
815	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
816	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
817	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
818	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
819	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
820	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
821	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
822	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
823	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
824	Figure 4. CV2, BMP4 and Tsg form a Ternary Complex that Inhibits BMP Signaling, otherFeat=[]-->, belongsTo=fig_caption
825	(A) DSS crosslinking showing that CV2 binds BMP4 directly., otherFeat=[]-->, belongsTo=fig_caption
826	(B) CV2 dose-dependently blocks BMP4-induced phosphorylation of endogenous Smad1 in, otherFeat=[]-->, belongsTo=fig_caption
827	mouse L-cells; BMP4 was added for 30 min in serum-free medium after pre-incubation with, otherFeat=[]-->, belongsTo=fig_caption
828	CV2 protein for 2 hours at 4?C., otherFeat=[]-->, belongsTo=fig_caption
829	(C) Co-immunoprecipitation demonstrating that purified CV2 binds Tsg., otherFeat=[]-->, belongsTo=fig_caption
830	(D) Tsg facilitates the binding of CV2 to BMP4., otherFeat=[]-->, belongsTo=fig_caption
831	(E) CV2, BMP4 and Tsg form a ternary complex. Left panel shows DSS crosslinking products, otherFeat=[]-->, belongsTo=fig_caption
832	stained with anti-CV2 antibody. Right panel, same samples examined with anti-BMP, otherFeat=[]-->, belongsTo=fig_caption
833	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
834	Page 18, otherFeat=[]-->, belongsTo=nota_cab_pie
835	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
836	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
837	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
838	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
839	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
840	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
841	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
842	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
843	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
844	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
845	monoclonal antibody (anti-Tsg antibody showed smears due to crosslinking of Tsg with itself)., otherFeat=[]-->, belongsTo=parr
846	Tsg protein alone is not recognized by either antibody (not shown)., otherFeat=[]-->, belongsTo=parr
847	(F) CV2 and Tsg additively block the binding of BMP4 to BMPR-1b-Fc., otherFeat=[]-->, belongsTo=parr
848	(G) Model of the molecular interactions of CV2, Tsg and BMP4 in a ternary complex., otherFeat=[]-->, belongsTo=parr
849	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
850	Page 19, otherFeat=[]-->, belongsTo=nota_cab_pie
851	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
852	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
853	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
854	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
855	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
856	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
857	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
858	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
859	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
860	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
861	Figure 5. CV2 and Chordin Bind to Each Other, otherFeat=[]-->, belongsTo=fig_caption
862	(A) Biacore sensograms of the CV2-Chordin interaction in real-time showing an average KD, otherFeat=[]-->, belongsTo=fig_caption
863	of 1.37 nM. The time at which the binding of CV2 protein stops and the buffer wash starts is, otherFeat=[]-->, belongsTo=fig_caption
864	indicated., otherFeat=[]-->, belongsTo=fig_caption
865	(B) Co-immunoprecipitation in solution showing that Chordin and BMP4 bind better to CV2, otherFeat=[]-->, belongsTo=fig_caption
866	in the presence of each other. Top panel shows Western blot immunostained with anti-Chordin,, otherFeat=[]-->, belongsTo=fig_caption
867	middle panel with monoclonal anti-BMP4, and bottom panel (loading control) with anti-CV2, otherFeat=[]-->, belongsTo=fig_caption
868	antibody., otherFeat=[]-->, belongsTo=fig_caption
869	(C) CV2, Chordin and BMP4 form a ternary complex. Left panel shows crosslinked products, otherFeat=[]-->, belongsTo=fig_caption
870	stained with BMP4 monoclonal antibody; the antigenicity of BMP4 in crosslinked complexes, otherFeat=[]-->, belongsTo=fig_caption
871	with Chd and CV2 increases (the unbound BMP4 dimer band indicates the amount of BMP4, otherFeat=[]-->, belongsTo=fig_caption
872	protein present in the complexes). The right panel the same products stained for myc-tagged, otherFeat=[]-->, belongsTo=fig_caption
873	Xenopus Chordin protein. The position of the BMP4/CV2/Chordin ternary complex is, otherFeat=[]-->, belongsTo=fig_caption
874	indicated., otherFeat=[]-->, belongsTo=fig_caption
875	(D) CV2 binds better to Chordin cleavage products than to Chordin full-length protein. Some, otherFeat=[]-->, belongsTo=fig_caption
876	cleavage products were present in the Chordin protein preparation, and these were enriched in, otherFeat=[]-->, belongsTo=fig_caption
877	lane 2., otherFeat=[]-->, belongsTo=fig_caption
878	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
879	Page 20, otherFeat=[]-->, belongsTo=nota_cab_pie
880	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
881	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
882	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
883	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
884	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
885	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
886	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
887	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
888	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
889	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
890	(E) BMP4 pre-bound to Chordin enhances the binding preference of CV2 beads for full-length, otherFeat=[]-->, belongsTo=parr
891	Chordin (lane 4). At this exposure level the binding of full-length Chordin to CV2 is, otherFeat=[]-->, belongsTo=parr
892	undetectable (lane 2), but is greatly increased by adding Xlr or BMP4 (lanes 3 and 4)., otherFeat=[]-->, belongsTo=parr
893	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
894	Page 21, otherFeat=[]-->, belongsTo=nota_cab_pie
895	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
896	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
897	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
898	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
899	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
900	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
901	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
902	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
903	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
904	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
905	Figure 6. The pro-BMP Function of CV2 is Revealed in Epistatic Experiments with Chordin or, otherFeat=[]-->, belongsTo=fig_caption
906	Tolloid, otherFeat=[]-->, belongsTo=fig_caption
907	(A) Expression of the eye field marker Rx2a in uninjected Xenopus late neurula embryo (n=45),, otherFeat=[]-->, belongsTo=fig_caption
908	anterior view., otherFeat=[]-->, belongsTo=fig_caption
909	(B) Chordin protein injection (2 M, 60 nl) into the blastocoele at late blastula (stage 9.5), otherFeat=[]-->, belongsTo=fig_caption
910	caused dorsalization and an increase in Rx2a expression (n=54)., otherFeat=[]-->, belongsTo=fig_caption
911	(C) CV2-depleted hosts were more sensitive to the anti-BMP effects of Chordin, as indicated, otherFeat=[]-->, belongsTo=fig_caption
912	by the expansion in the Rx2a domain (n=48)., otherFeat=[]-->, belongsTo=fig_caption
913	(D) Uninjected early neurula (stage 13, side view) showing Otx2 expression in the future, otherFeat=[]-->, belongsTo=fig_caption
914	forebrain and midbrain regions (n=19)., otherFeat=[]-->, belongsTo=fig_caption
915	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
916	Page 22, otherFeat=[]-->, belongsTo=nota_cab_pie
917	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
918	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
919	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
920	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
921	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
922	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
923	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
924	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
925	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
926	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
927	(E) Chordin protein injection expands Otx2 in wild-type embryos (n=25)., otherFeat=[]-->, belongsTo=parr
928	(F) CV2 depletion sensitizes the embryo to the effects of Chordin on Otx2 (n=23). Note that, otherFeat=[]-->, belongsTo=parr
929	the border of Otx2 expression expands posteriorly., otherFeat=[]-->, belongsTo=parr
930	(G?H) qRT-PCR analysis of the D-V markers Chd, CV2 and Szl after Chordin protein injection, otherFeat=[]-->, belongsTo=parr
931	into wild-type and CV2-depleted embryos at late blastula. The bars indicate standard deviation, otherFeat=[]-->, belongsTo=parr
932	between two groups of seven embryos each., otherFeat=[]-->, belongsTo=parr
933	(J and K) Anterior views of uninjected control or embryo microinjected four times with 250, otherFeat=[]-->, belongsTo=parr
934	pg of DN-Xlr mRNA, which inhibits the proteolytic degradation of Chordin. Note that the, otherFeat=[]-->, belongsTo=parr
935	Otx2-positive forebrain (fb), midbrain, and cement gland (cg) regions are expanded, consistent, otherFeat=[]-->, belongsTo=parr
936	with the anti-BMP effects of Tolloid inhibition (n=27)., otherFeat=[]-->, belongsTo=parr
937	(L) In CV2 depleted embryos Otx2 expression is greatly expanded by DN-Xlr mRNA (n=27)., otherFeat=[]-->, belongsTo=parr
938	The dotted line indicates the eye field (eye), which is more weakly stained by Otx2., otherFeat=[]-->, belongsTo=parr
939	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
940	Page 23, otherFeat=[]-->, belongsTo=nota_cab_pie
941	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
942	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
943	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
944	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
945	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
946	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
947	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
948	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
949	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
950	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
951	Figure 7. Model of the Molecular Interaction of CV2, Chordin, Tsg and BMP4, otherFeat=[]-->, belongsTo=fig_caption
952	(A) Model of the regulation of D-V patterning by a network of extracellular proteins secreted, otherFeat=[]-->, belongsTo=fig_caption
953	by the dorsal and ventral centers of the Xenopus gastrula. Arrows in black indicate direct, otherFeat=[]-->, belongsTo=fig_caption
954	protein-protein interactions in the extracellular space, blue arrows transcriptional regulation, otherFeat=[]-->, belongsTo=fig_caption
955	by the BMP-responsive transcription factors Smad1/5/8, and the red arrow the hypothetical, otherFeat=[]-->, belongsTo=fig_caption
956	flux of Chordin/ADMP/BMP from the dorsal toward the ventral center of the embryo, where, otherFeat=[]-->, belongsTo=fig_caption
957	it would bind to CV2. This model of D-V patterning is self-regulating because at low BMP, otherFeat=[]-->, belongsTo=fig_caption
958	levels the transcription of the BMP-like molecule ADMP is activated, and at high-BMP levels, otherFeat=[]-->, belongsTo=fig_caption
959	the BMP antagonist CV2 and the tolloid inhibitor Sizzled are upregulated (Reversade and De, otherFeat=[]-->, belongsTo=fig_caption
960	Robertis, 2005; Lee et al., 2006). The function of Tsg is to both increase BMP inhibition by, otherFeat=[]-->, belongsTo=fig_caption
961	CV2 and Chd and to promote BMP4 signaling in their absence. The tolloid protease Xlr cleaves, otherFeat=[]-->, belongsTo=fig_caption
962	Chordin/ADMP/BMP complexes, releasing active BMPs concentrated on the ventral side., otherFeat=[]-->, belongsTo=fig_caption
963	(B) Model in which Chordin flow would help transport BMPs and Chordin from the dorsal to, otherFeat=[]-->, belongsTo=fig_caption
964	the ventral side of the Xenopus embryo. Three possible outcomes are indicated., otherFeat=[]-->, belongsTo=fig_caption
965	Ambrosio et al., otherFeat=[]-->, belongsTo=nota_cab_pie
966	Page 24, otherFeat=[]-->, belongsTo=nota_cab_pie
967	Dev Cell. Author manuscript; available in PMC 2009 February 1., otherFeat=[]-->, belongsTo=nota_cab_pie
968	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
969	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
970	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
971	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
972	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
973	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
974	NIH-PA, otherFeat=[]-->, belongsTo=nota_cab_pie
975	Author, otherFeat=[]-->, belongsTo=nota_cab_pie
976	Manuscript, otherFeat=[]-->, belongsTo=nota_cab_pie
==============================
0	Crossveinless-2 Is a BMP Feedback Inhibitor that Binds Chordin/-->id=0, page=0, size=19, fam=Helvetica, col=#000000, type=title, textLines=3--->[]--->title	Crossveinless-2 Is a>>> that Binds Chordin/
1	BMP to Regulate Xenopus Embryonic Patterning-->id=0, page=0, size=19, fam=Helvetica, col=#000000, type=title, textLines=3--->[]--->title	BMP to Regulate Xeno>>>Embryonic Patterning
2	Andrea L. Ambrosio1,2, Vincent F. Taelman1,2, Hojoon X. Lee1,2, Carrie Metzinger1, Catherine Coffinier1, and E.M. De Robertis1,* 1 Howard Hughes Medical Institute and Department of Biological Chemistry University of California Los Angeles, CA 90095-1662, USA-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->note	Andrea L. Ambrosio1,>>>, CA 90095-1662, USA
3	SUMMARY-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	SUMMARY>>>SUMMARY
4	Vertebrate Crossveinless-2 (CV2) is a secreted protein that can potentiate or antagonize BMP-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->note	Vertebrate Crossvein>>>te or antagonize BMP
5	signaling. Through embryological and biochemical experiments we find that: 1) CV2 functions as a BMP4 feedback inhibitor in ventral regions of the Xenopus embryo; 2) CV2 complexes with Twisted gastrulation and BMP4; 3) CV2 is not a substrate for tolloid proteinases; 4) CV2 binds to purified Chordin protein with high affinity (KD in the 1 nM range); 5) CV2 binds even more strongly to Chordin proteolytic fragments resulting from Tolloid digestion or to full-length Chordin/BMP-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->note	signaling. Through e>>>l-length Chordin/BMP
6	complexes; 6) CV2 depletion causes the Xenopus embryo to become hypersensitive to the anti-BMP effects of Chordin overexpression or tolloid inhibition. We propose that the CV2/Chordin interaction may help coordinate BMP diffusion to the ventral side of the embryo, ensuring that BMPs liberated from Chordin inhibition by tolloid proteolysis cause peak signaling levels.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	complexes; 6) CV2 de>>>ak signaling levels.
7	INTRODUCTION-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->title	INTRODUCTION>>>INTRODUCTION
8	The histotypic differentiation of ectodermal and mesodermal cells along the dorsal-ventral (DV) axis of the Xenopus embryo is determined by the levels of Bone Morphogenetic Proteins (BMPs) to which cells are exposed in the extracellular space (reviewed in De Robertis,-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	The histotypic diffe>>>ewed in De Robertis,
9	2006). High BMP levels induce differentiation into epidermis or blood, while BMP inhibition causes cells to become neural tissue or notochord. In order to develop successfully, the embryo has to establish a robust BMP gradient that remains stable throughout gastrulation. It was-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	2006). High BMP leve>>>gastrulation. It was
10	originally thought that this gradient resulted from the simple diffusion of BMP antagonists,-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	originally thought t>>> of BMP antagonists,
11	such as Chordin or Noggin, secreted by a dorsal center called the Spemann organizer (Sasai et al., 1995; Zimmerman et al., 1996). More recently, it has been observed that both the dorsal-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	such as Chordin or N>>>that both the dorsal
12	and ventral regions of the embryo secrete BMPs and anti-BMP molecules, but under opposite transcriptional control (Reversade and De Robertis, 2005).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	and ventral regions >>> De Robertis, 2005).
13	Crossveinless-2 (CV2) is one of the genes required for the formation of crossveins in the Drosophila wing (Conley et al., 2000; Blair, 2007). Since crossvein determination requires high local levels of BMP signals, this indicated that CV2 was involved in the BMP pathway, presumably acting as a pro-BMP (Conley et al., 2000). Interestingly, another crossveinless mutation, Crossveinless-1 (cv, cv-1) affected a new member of the Twisted Gastrulation family,-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Crossveinless-2 (CV2>>>Gastrulation family,
14	*Correspondence: ederobertis@mednet.ucla.edu Tel. (310) 206-1401 Fax (310) 206-2008.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->parr	*Correspondence: ede>>> Fax (310) 206-2008.
15	2These authors contributed equally to this work.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->parr	2These authors contr>>>qually to this work.
16	Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->parr	Publisher's Disclaim>>>iew of the resulting
17	proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	proof before it is p>>>scovered which could
18	affect the content, and all legal disclaimers that apply to the journal pertain.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	affect the content, >>>the journal pertain.
19	NIH Public Access-->id=10, page=0, size=31, fam=Times, col=#000000, type=title, textLines=1--->[]--->note	NIH Public Access>>>NIH Public Access
20	Author Manuscript-->id=0, page=0, size=19, fam=Helvetica, col=#000000, type=title, textLines=3--->[]--->note	Author Manuscript>>>Author Manuscript
21	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=12, page=0, size=14, fam=Times, col=#b5c7de, type=title, textLines=1--->[]--->parr	Dev Cell. Author man>>>PMC 2009 February 1.
22	Published in final edited form as: Dev Cell. 2008 August ; 15(2): 248­260. doi:10.1016/j.devcel.2008.06.013.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Published in final e>>>.devcel.2008.06.013.
23	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
24	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
25	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
26	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
27	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
28	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
29	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
30	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
31	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
32	dTsg-2 (Vilmos et al., 2005; Shimmi et al., 2005). The cloning of Drosophila CV2 cDNA by the Blair group revealed that it was structurally related to a family of proteins such as Chordin, Sog, and Kielin that contain CR (Cysteine-Rich, also called vWFc domains) modules known to bind BMPs (Conley et al., 2000). CV2 contains 5 CR domains and a partial von Willebrand Factor D (vWFd) domain that is involved in interactions with cell surface proteins (Serpe et al., 2008). In vertebrates, a mouse homologue had a similar overall structure, except for an additional carboxy-terminal Trypsin Inhibitor-like (TIL) domain (Coffinier et al., 2002).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	dTsg-2 (Vilmos et al>>>inier et al., 2002).
33	Although the ability of CV2 to bind BMPs is very clear (Rentzsch et al., 2006; Zhang et al.,-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Although the ability>>> 2006; Zhang et al.,
34	2007), CV2's effects on signaling overall can vary. On the one hand, CV2 has been shown to function in vivo as a pro-BMP molecule during mouse organogenesis (Ikeya et al., 2006),-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	2007), CV2's effects>>>Ikeya et al., 2006),
35	zebrafish gastrulation (Rentzsch et al., 2006), and crossvein formation in the fly wing (Conley et al., 2000; Ralston and Blair, 2005; O'Connor et al., 2006). On the other hand, potent-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	zebrafish gastrulati>>>e other hand, potent
36	inhibitory activity of CV2 on BMPs has been described during endothelial cell differentiation (Moser et al., 2003), frog embryogenesis (Coles et al., 2004), human osteogenic differentiation (Binnerts et al., 2004) and in biochemical studies (Zhang et al., 2007). Thus, CV2 displays-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	inhibitory activity >>>. Thus, CV2 displays
37	opposing activities depending on the biological context in which it is studied. This investigation was undertaken to clarify the mechanistic bases for these divergent functions.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	opposing activities >>>divergent functions.
38	We examined CV2 activity in vivo and in vitro using embryological and biochemical assays that lead us to conclude that the overall function of CV2 during Xenopus D-V development is to serve as a local BMP feedback inhibitor. When Chordin is depleted, the transcriptional-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	We examined CV2 acti>>> the transcriptional
39	upregulation of CV2 lowers BMP signaling levels in the ventral side of the embryo; when both CV2 and Chordin are depleted, severe ventralization of embryonic pattern occurs. We-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	upregulation of CV2 >>>c pattern occurs. We
40	investigated the interactions of CV2 with other proteins involved in D-V patterning and found that CV2 forms a ternary complex with BMP4 and Tsg. Intriguingly, we also discovered that CV2 binds to full-length Chordin protein, and even more strongly to Chordin cleavage-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	investigated the int>>> to Chordin cleavage
41	fragments resulting from digestion by tolloid metalloproteinases. Finally, in vivo experiments demonstrated that when CV2 was depleted, the anti-BMP activity of overexpressed Chordin or of dominant-negative tolloids (DN-Xlr) was enhanced. Thus, in addition to its role as a-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	fragments resulting >>>ion to its role as a
42	feedback inhibitor, CV2 exerts pro-BMP effects via some form of Chordin antagonism. We propose that the action of CV2 on BMP/Chordin diffusion to the ventral side of the gastrula explains in part the pro-BMP effects of CV2.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	feedback inhibitor, >>>-BMP effects of CV2.
43	RESULTS-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->title	RESULTS>>>RESULTS
44	CV2 Is a BMP Feedback Inhibitor in Xenopus-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	CV2 Is a BMP Feedbac>>>Inhibitor in Xenopus
45	In Xenopus, CV2 transcripts are expressed in regions of high BMP signaling (such as the ventral blastopore; see Figure 1A and Supplementary Figure S1), as is the case for mouse and zebrafish CV2 (Coffinier et al., 2002; Rentzsch et al., 2006). We generated a morpholino oligomer-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	In Xenopus, CV2 tran>>> morpholino oligomer
46	against CV2 (CV2 MO) that targets the first 25 nucleotides of the CV2 mRNA coding sequence. CV2 MO inhibited the translation of microinjected xCV2 mRNA (Figure S4A). Its effects were specific, since the CV2 MO phenotype could be rescued by the co-injection of mouse CV2-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	against CV2 (CV2 MO)>>>jection of mouse CV2
47	mRNA (Figure S4B-C), and similar phenotypes were observed with two other CV2 MOs that targeted non-overlapping sequences in the CV2 5 untranslated region (see Methods). In CV2 MO injected embryos, ventral expression of CV2 transcripts was increased (Figure 1B).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	mRNA (Figure S4B-C),>>>creased (Figure 1B).
48	Additional high-BMP markers such as Vent-1 and Sizzled were also increased (Figures 1D, 2D inset, and 2E), while dorso-anterior (low-BMP) markers such as Six3, Goosecoid and Xenopus embryos depleted of CV2 showed increased levels of Smad1 phosphorylation, when compared to uninjected controls incubated for the same times (Figure 1F). Note that at three stages of gastrula and neurula, pSmad1 levels were consistently higher in CV2 MO embryos. We conclude from these experiments that the overall function of CV2 in the Xenopus embryo is to serve as a BMP4 antagonist induced by BMP signaling. In other words, CV2 is a feedback inhibitor of BMP4 signaling.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Additional high-BMP >>>r of BMP4 signaling.
49	Chordin were decreased (Figures 1E, 2G and 2H). To determine whether the transcriptional-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Chordin were decreas>>> the transcriptional
50	upregulation of ventral genes was caused by higher levels of BMP4 signaling, BMP4 MO was co-injected with CV2 MO. Depletion of BMP4 abolished the increase of CV2 transcripts caused by CV2 depletion (Figure 1A to 1C). In addition, we examined the levels of-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	upregulation of vent>>>amined the levels of
51	phosphorylation of Smad1, an effector protein phosphorylated in response to BMP activity.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	phosphorylation of S>>>nse to BMP activity.
52	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
53	Page 2-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 2>>>Page 2
54	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
55	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
56	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
57	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
58	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
59	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
60	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
61	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
62	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
63	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
64	That said, it is important to note that at later developmental stages, CV2 morphants displayed a reduction of structures such as the head, eyes, cement gland, endoderm, and dorsal and ventral fins (Figures S1­S3). These phenotypes are generally indicative of pro-BMP effects (see also Little and Mullins, 2006). We will further address the pro-BMP effects of CV2 in Figure 6.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	That said, it is imp>>> of CV2 in Figure 6.
65	CV2 and Chordin Have Similar In Vivo Activities-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	CV2 and Chordin Have>>>r In Vivo Activities
66	Since CV2 and Chordin are secreted BMP4 antagonists expressed on opposite sides of the-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Since CV2 and Chordi>>>pposite sides of the
67	embryo, we next tested whether one gene could ameliorate the loss of the other by depleting CV2 and Chordin simultaneously. Knockdown of either CV2 or Chordin alone increased levels of CV2 and Szl transcripts in the ventral side (Figure 2A to 2F) and inhibited the dorsal genes Goosecoid and Chordin (Figure 2G and 2H). Double depletion of CV2 and Chordin caused an increase of these effects on D-V marker genes (Figure 2D to 2H). The increase in BMP-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	embryo, we next test>>> The increase in BMP
68	ventralizing signals in double CV2 and Chordin morphants was confirmed by endogenous-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	ventralizing signals>>>firmed by endogenous
69	Smad1/5/8 phosphorylation levels at mid gastrula (Figure 2I). These results suggest that when Chordin is depleted (Oelgeschläger et al., 2003), the transcriptional upregulation of the BMP antagonist CV2 on the ventral side, induced by the increase in BMP signaling, replaces the-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Smad1/5/8 phosphoryl>>>naling, replaces the
70	loss of Chordin, partially restoring the BMP gradient. We conclude that the overall function of CV2 and Chordin is to antagonize BMP signaling from opposite sides of the embryo.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	loss of Chordin, par>>>sides of the embryo.
71	CV2 is not Cleaved by Tolloid-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	CV2 is not Cleaved b>>>t Cleaved by Tolloid
72	Chordin activity is controlled through proteolysis by members of the tolloid (Tld) family-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Chordin activity is >>>tolloid (Tld) family
73	(Piccolo et al., 1997). In Xenopus, these metalloproteinases include Xolloid-related (Xlr) and BMP1 (Dale et al., 2002). The analysis of secreted CV2 had shown that CV2 protein is cleaved into two fragments covalently bound by a disulfide bridge (Binnerts et al., 2004; Kamimura et al., 2004). In zebrafish, it was suggested that CV2 function is regulated by proteolysis, and that this cleavage would switch CV2 activity from an anti-BMP to a pro-BMP molecule in the extracellular space (Rentzsch et al., 2006). However, the CV2 cleavage site maps to the-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(Piccolo et al., 199>>>age site maps to the
74	sequence GDPH (Rentzsch et al., 2006). In the mucins, GDPH constitutes a motif that marks post-translational autocatalytical cleavage by a non-enzymatic mechanism triggered by the low pH present in the secretory pathway (Lidell et al., 2003). Interestingly, CV2 proteins from all species sequenced, which include Drosophila, zebrafish, mouse, chick, and Xenopus, contain a conserved GDPH motif in their vWFd domain (Figure 2J and data not shown).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	sequence GDPH (Rentz>>>and data not shown).
75	We compared the digestion profile of Chordin and CV2 proteins by the tolloid-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	We compared the dige>>>teins by the tolloid
76	metalloproteinases Xlr and BMP1. After 18 hours of incubation at 30°C, full-length Chordin was completely digested by either enzyme (Figure 2K, lanes 1­3), whereas CV2 was entirely resistant to proteolysis by Xlr or BMP1 (Figures 2K, lanes 4­6). Purified mouse CV2 protein (R&D Systems) consisted of three bands in reducing SDS gels followed by Western blot using an anti-mouse CV2 antibody (Figure 2K, lane 4). The most prominent bands corresponded to the N-terminal and C-terminal fragments (50 and 37 kDa, respectively), and the 80 kDa upper band corresponded to the full-length form. When purified CV2 protein was incubated in the (Lidell et al., 2003) and is not proteolytically digested in the extracellular space by tolloid proteinases.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	metalloproteinases X>>>tolloid proteinases.
77	absence of enzyme for 18 hours at 37°C in buffers of pH ranging from 7.5 to 4.5, disappearance of full-length CV2 was observed at a pH equal or lower than pH 5.5 (Figure 2K, lanes 7­10). These results strongly suggest that CV2 is autocatalytically processed in the secretory pathway-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	absence of enzyme fo>>>he secretory pathway
78	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
79	Page 3-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 3>>>Page 3
80	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
81	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
82	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
83	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
84	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
85	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
86	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
87	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
88	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
89	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
90	We next reinvestigated whether the switch between the pro-BMP and anti-BMP activities of CV2 could be explained by proteolytic processing. This notion was based on experiments in which a zebrafish mRNA construct consisting only of the N-terminal CR BMP-binding modules revealed strong pro-BMP effects (Rentzsch et al., 2006). We prepared similar-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	We next reinvestigat>>> We prepared similar
91	constructs for Xenopus CV2 terminating at the GDPH cleavage site, or consisting of a secreted form of the vWFd domain (Figure 2J). Ventral microinjection of full-length CV2 mRNA into Xenopus 8-cell embryos caused secondary axis formation (Figure 2L). However, neither the-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	constructs for Xenop>>>However, neither the
92	N-terminal nor the C-terminal fragments of the extracellular domain had any phenotypic effects (Figure 2M and 2N). Constructs of mouse (data not shown) CV2 CR domains were also devoid of activity (except for a weak anti-BMP activity, resulting in a posteriorized anus phenotype, observed for the mouse CV-2 N-terminal construct, data not shown). Thus, we were unable to confirm a role for regulated proteolysis in switching CV2 into a pro-BMP function. In-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	N-terminal nor the C>>>pro-BMP function. In
93	Drosophila, it has also been recently reported that proteolytic cleavage of CV2 is not required for its pro-BMP activity, and that a fragment consisting of the only CV2 CR domains is inactive (Serpe et al., 2008). We conclude that both the CR modules and the vWFd domain are required for the BMP-modulating activity of Xenopus and mouse CV2.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Drosophila, it has a>>>nopus and mouse CV2.
94	Depletion of CV2 Reveals the Pro-BMP Activity of Tsg-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Depletion of CV2 Rev>>>-BMP Activity of Tsg
95	It has been shown that Tsg can have either an anti-BMP or a pro-BMP activity depending on the presence of Chordin (Oelgeschläger et al., 2000; Larraín et al., 2001; Little and Mullins,-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	It has been shown th>>> Little and Mullins,
96	2004; Xie and Fisher, 2005). We next examined the effect of knocking down Tsg in the context of Xenopus embryos depleted of both CV2 and Chordin. Double morphant embryos displayed a very large increase in BMP signaling levels reflected by up-regulation of CV2 expression-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	2004; Xie and Fisher>>>on of CV2 expression
97	(Figure 3A). However, when Tsg was also depleted by Tsg MO co-injection, CV2 expression almost disappeared (Figure 3B; see Figure S5 for a complete set of controls for these-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(Figure 3A). However>>>f controls for these
98	experiments). These experiments reveal a potent pro-BMP activity for endogenous Tsg in the absence of CV2 and Chordin in Xenopus embryos.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	experiments). These >>> in Xenopus embryos.
99	Tsg Increases the Anti-BMP Activity of CV2-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Tsg Increases the An>>>-BMP Activity of CV2
100	To show that Tsg is also important for inhibiting BMP signaling, we examined the effects of Tsg gain-of function and loss-of-function in embryos injected with CV2 protein into the blastocoele. The phenotype obtained after CV2 injection (using the same predominantly-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	To show that Tsg is >>>e same predominantly
101	cleaved protein preparation shown in Figure 2K, lane 4) was a dorsalized (low-BMP) embryo with a shortened axis, enlarged head and increased expression of dorsal-anterior markers such as Six3, Xag1, Krox20, and Sox3 (Figure 3C and E). When CV2 protein was injected into Tsgdepleted embryos, they were much less affected and displayed almost normal levels of dorsal marker genes (Figure 3D, compare to 3C). In overexpression experiments, co-injection of Tsg and CV2 proteins showed cooperation between the two proteins, with an expansion of the panneural Sox3 marker, indicating lower levels of BMP signaling (Figure 3F). Taken together,-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	cleaved protein prep>>>3F). Taken together,
102	these results indicate that Tsg is required for CV2 protein to display its anti-BMP effect. This finding is in some ways analogous to previous studies of Tsg and Chordin; we therefore sought to determine whether the underlying biochemistry is also analogous.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	these results indica>>>y is also analogous.
103	CV2 Forms a Ternary Complex with Tsg and BMP4 had been observed previously (Moser et al., 2003; Coles et al., 2004; Binnerts et al., 2004; Zhang et al., 2007).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	CV2 Forms a Ternary >>>Zhang et al., 2007).
104	CV2 bound BMP4, and this binding was specific as it could be competed by a 10-fold excess of BMP2, but not of TGF-1 or Nodal, in immunoprecipitation assays (Figure 4A and data not shown). In addition, BMP4 signaling in L-cell fibroblasts was inhibited by pre-incubation with CV2 protein in a dose-dependent way (Figure 4B). BMP binding and its inhibition by CV2-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	CV2 bound BMP4, and >>>ts inhibition by CV2
105	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
106	Page 4-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 4>>>Page 4
107	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
108	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
109	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
110	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
111	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
112	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
113	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
114	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
115	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
116	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
117	We investigated Tsg/CV2 interactions by performing co-immunoprecipitation experiments in which anti-CV2 antibody was bound to protein G beads. These beads were added to a mixture of CV2 and Tsg proteins, which bound to each other in solution (Figure 4C, lane 2). We first tested whether Tsg was able to influence the binding of BMP4 to CV2 using this CV2 pull--->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	We investigated Tsg/>>>using this CV2 pull-
118	down assay. Increasing amounts of BMP4 were pre-incubated with CV2 in the presence of a constant amount of Tsg (Figure 4D). BMP4 bound better in the presence of Tsg (Figure 4D,-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	down assay. Increasi>>>e of Tsg (Figure 4D,
119	lanes 5­7), indicating that Tsg protein facilitates the binding of BMP4 to CV2. This was similar to what has been reported for Chordin/BMP4/Tsg complexes (Oelgeschläger et al., 2000; Ross et al., 2001; Larraín et al., 2001)-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	lanes 5­7), indicati>>>arraín et al., 2001)
120	Given the similar structure and activities of Chordin and CV2, we asked whether a CV2-TsgBMP4 ternary complex was formed. To do so, we chemically cross-linked a pre-incubated-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Given the similar st>>>nked a pre-incubated
121	mixture of CV2, Tsg and BMP4 proteins with DSS. We identified a complex recognized by-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	mixture of CV2, Tsg >>>omplex recognized by
122	antibodies specific for either CV2 or BMP4, which was only formed in samples containing the three proteins (Figure 4E). We conclude that CV2, like Chordin, forms a ternary complex-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	antibodies specific >>>ms a ternary complex
123	together with BMP4 and Tsg. This interaction may help explain why Drosophila mutations in the either the cv-2 or dTsg2 (cv, cv-1) genes produce identical crossveinless phenotypes in the fly wing (Conley et al., 2000; Shimmi et al., 2005; Vilmos et al., 2005).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	together with BMP4 a>>>ilmos et al., 2005).
124	CV2 Inhibits the Binding of BMP4 to BMPR-1b-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	CV2 Inhibits the Bin>>>g of BMP4 to BMPR-1b
125	To test whether CV2 functions as an antagonist by preventing the binding of BMP4 to its-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	To test whether CV2 >>>nding of BMP4 to its
126	receptor, we used a soluble BMPR-1b protein fused to an immunoglobulin constant region (BMPR-1b-Fc). The preincubation of BMP4 with CV2 was able to partially inhibit BMP4 binding to this receptor (Figure 4F, compare lanes 1 and 2), in agreement with other-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	receptor, we used a >>>agreement with other
127	biochemical studies showing that a CV2 domain blocks binding to BMPRs type I and II (Zhang et al., 2008). The CV2 inhibitory effect was increased additively when the same experiment was performed in the presence of Tsg (Figure 4F, lane 4). These in vitro experiments tested-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	biochemical studies >>>o experiments tested
128	only the inhibition of binding BMP4 to BMPR-1b and do not exclude binding of CV2 to BMP receptors such as BMPR-1a (Serpe et al., 2008). Figure 4G shows a model of how a CV2/Tsg/ BMP4 ternary complex could serve as a negative feedback regulator of BMP signaling in the ventral region of the embryo.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	only the inhibition >>>egion of the embryo.
129	CV2 Binds to Chordin-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	CV2 Binds to Chordin>>>CV2 Binds to Chordin
130	Mutations affecting crossvein formation in the fly wing have suggested that both Sog and CV2 are required for reaching peak BMP signalling in the presumptive territory of the crossvein-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Mutations affecting >>>ory of the crossvein
131	(Ralston and Blair, 2005; O'Connor et al., 2006; Blair, 2007). This suggested to us that direct molecular interactions between Chordin and CV2 might exist. Using surface plasmon-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(Ralston and Blair, >>>sing surface plasmon
132	resonance (Biacore) we found that CV2 bound to Chordin protein immobilized on a sensor-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	resonance (Biacore) >>>obilized on a sensor
133	chip (Figure 5A) or in solution in pull-down assays (Figure S6). Purified CV2 bound to Chordin with very high affinity, with a KD in the low nanomolar range (1.4 ± 0.4 nM) (Figure 5A). To our surprise, pull-down assays also showed that Chordin pre-incubated with BMP4 bound much better to CV2 pre-bound to antibody beads (Figure 5B, compare lanes 2 and 3). We panel). After digestion with Xlr, the resulting Chordin proteolytic fragments showed a much higher affinity for CV2; this was particularly striking for the Chordin middle fragment lacking both CR1 and CR4 (Figure 5D, compare lanes 2 and 3 in the middle western blot panel).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	chip (Figure 5A) or >>>western blot panel).
134	conclude from these results that purified Chordin can bind to CV2 in the 1 nM affinity range.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	conclude from these >>>1 nM affinity range.
135	CV2 Binds with Higher Affinity to Chordin Cleaved by Tolloid-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	CV2 Binds with Highe>>>n Cleaved by Tolloid
136	We next investigated whether a molecular complex of CV2-Chordin-BMP4 might be formed. To answer this question biochemically, we pre-incubated the three proteins prior to crosslinking with DSS. We were able to identify, using anti-BMP4 or anti-Chordin antibodies, a high molecular weight complex which formed only in the presence of the three proteins-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	We next investigated>>>f the three proteins
137	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
138	Page 5-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 5>>>Page 5
139	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
140	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
141	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
142	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
143	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
144	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
145	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
146	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
147	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
148	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
149	(Figure 5C, lanes 4 and 8). This suggested that Chordin, BMP4 and CV2 can indeed form a tri-molecular complex. (Attempts to identify quaternary complexes containing also Tsg failed due to the formation of high molecular weight aggregates.)-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(Figure 5C, lanes 4 >>> weight aggregates.)
150	We next asked whether CV2 bound equally to full-length Chordin or to its proteolytic cleavage fragments. Chordin is specifically cleaved by metalloproteinases from the tolloid family, predominantly by the ventrally-expressed Xlr (Dale et al., 2002; Lee et al., 2006). This-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	We next asked whethe>>> et al., 2006). This
151	mechanism is crucial in D-V patterning because it releases active BMPs from Chordin (Piccolo et al., 1997). CV2 is expressed in the ventral side of the embryo, in a region overlapping with the Xlr expression domain, but it is not itself digested by this enzyme. Using affinity-purified Xlr enzyme (Lee et al., 2006), we digested Xenopus Chordin for 15 min or 2 h (Figure 5D), and incubated the digested samples with CV2 pre-bound to beads. Using an anti-Chordin-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	mechanism is crucial>>>sing an anti-Chordin
152	antibody that recognizes the Chordin internal fragment (anti-I-Chordin; Piccolo et al., 1997), it was found that the full-length protein, as well as minor cleaved bands present in the untreated Chordin sample (which became enriched with respect to the full length protein during this procedure), could be pulled down by the CV2 beads (Figure 5D, lanes 1 and 2, see middle-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	antibody that recogn>>> 1 and 2, see middle
153	In addition, we investigated the effect of BMP4 on the affinity of Chordin for CV2 pre-bound on antibody beads. The experiment in Figure 5E shows that even at exposure levels at which the binding of uncleaved Chordin to CV2 was so low as to be undetectable, the affinity of preincubated full-length Chordin/BMP4 complex for CV2 on beads was greatly increased (Figure 5E, compare lanes 2 and 4). This experiment also confirmed that the affinity of Chordin binding is enhanced by Xlr digestion (Figure 5E, compare lanes 2 and 3). We conclude from these-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	In addition, we inve>>> conclude from these
154	biochemical experiments that although CV2 is able to bind full-length Chordin protein, it binds better to the Chordin cleavage products resulting from Tolloid digestion or to full-length Chordin complexed with BMP4.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	biochemical experime>>>complexed with BMP4.
155	Biological Interactions between CV2 and Chordin-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Biological Interacti>>>ween CV2 and Chordin
156	We unexpectedly discovered that CV2 and Chordin had strong interactions in vitro. In order to determine whether these biochemical observations had in vivo relevance, we analyzed the phenotypic effects of Chordin overexpression in CV2-depleted embryos. As shown earlier (Figures 1 and 2), morpholino experiments had revealed primarily anti-BMP effects for-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	We unexpectedly disc>>>anti-BMP effects for
157	endogenous CV2 in early Xenopus embryos. However, when CV2-depleted embryos were-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	endogenous CV2 in ea>>>epleted embryos were
158	challenged by microinjection of 28 ng of recombinant Chordin protein into the blastocoele just before gastrulation (stage 9.5), the anti-BMP effects of Chordin were markedly increased, as reflected by the expansion of the eye marker Rx2a and the forebrain/midbrain marker, Otx2-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	challenged by microi>>>idbrain marker, Otx2
159	(Figure 6A to F). Quantitative RT-PCR analyses of the dorsal marker Chordin and the ventral markers CV2 and Sizzled confirmed that the dorsalizing effect of Chordin microinjection was enhanced by CV2 MO (Figure 6G to 6I). Thus, the depletion of CV2 greatly sensitized the embryo to the effects of exogenous Chordin protein.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(Figure 6A to F). Qu>>>ous Chordin protein.
160	We next asked whether increasing the levels of endogenous Chordin would also reveal-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	We next asked whethe>>>in would also reveal
161	biological interactions between Chordin and CV2. Tolloid metalloproteinases play a key-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	biological interacti>>>oteinases play a key
162	regulatory role in D-V patterning, and efficient dominant-negative tolloids are available (Lee et al., 2006). DN-Xlr mRNA (microinjected four times around the entire embryo), which-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	regulatory role in D>>>ntire embryo), which
163	partially inhibits its Chordin degradation, expanded the domain of expression of the anterior and dorsal marker Otx2. However, this anti-BMP phenotype (caused by increased stability of endogenous Chordin) was enhanced in embryos depleted of CV2 (Figure 6J to 6L). As shown earlier, the depletion of CV2 alone causes partially ventralized phenotypes (Figures 1 and 2B) which reflect an overall anti-BMP function for CV2, and these anti-BMP effects were greatly potentiated in double CV2/Chd morphants (Figure 2D). Thus, while low levels of Chordin and CV2 cooperate with one another as BMP antagonists, CV2 can also dampen the activity of excess Chordin. This latter activity may also be relevant to some of the pro-BMP effects observed in Figures S1­S3.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	partially inhibits i>>>ed in Figures S1­S3.
164	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
165	Page 6-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 6>>>Page 6
166	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
167	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
168	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
169	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
170	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
171	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
172	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
173	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
174	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
175	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
176	The most remarkable aspect of the Chordin or DN-Xlr overexpression results is that the overall effect of endogenous CV2 on signaling is switched from negative (anti-BMP) to positive (antiChordin, pro-BMP) when Chordin levels are increased. These in vivo experiments show that the effects of the ventral protein CV2 are dependent on the levels of the dorsal protein Chordin, and that CV2 can be either anti-BMP or pro-BMP. The hypersensitivity of CV2 morphants to Chordin indicates that one of the functions of CV2 is to dampen the effects of Chordin. This might be achieved, for example, by facilitating the removal and degradation of full-length-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	The most remarkable >>>ation of full-length
177	Chordin, its proteolytic fragments, or Chordin/BMP complexes after any or all of these factors bind to CV2 on the cell membranes of the ventral side of the wild-type embryo. Since CV2 is poorly diffusible (Rentzsch et al., 2006; Serpe et al., 2008), this anti-Chordin activity may act in combination with tolloid proteinases to concentrate BMPs for peak signalling ventrally (Figure 7).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Chordin, its proteol>>>entrally (Figure 7).
178	DISCUSSION-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->title	DISCUSSION>>>DISCUSSION
179	The function of CV2 presents an intriguing scientific mystery, because it has been found both to increase (Conley et al., 2000; Rentzsch et al., 2006; Ikeya et al., 2006; Kamimura et al.,-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	The function of CV2 >>>06; Kamimura et al.,
180	2004; Coles et al., 2004) or to antagonize (Moser et al., 2003; Coles et al., 2004; Binnerts et al., 2004; Zhang et al., 2007) BMP signaling according to the experimental setting. In this-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	2004; Coles et al., >>>tal setting. In this
181	study, we have used a combination of biochemical and Xenopus embryological assays in an-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	study, we have used >>>logical assays in an
182	attempt to unravel this puzzle. We found that CV2/Tsg/BMP complexes act as BMP inhibitors locally, and that the pro-BMP function of CV2 may result in part from its ability to bind Chordin and Chordin/BMP complexes originating from more dorsal locations. In the presence of tolloids, CV2 would serve to concentrate BMP signals ventrally.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	attempt to unravel t>>>P signals ventrally.
183	CV2 is a BMP4 Feedback Inhibitor-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	CV2 is a BMP4 Feedba>>>4 Feedback Inhibitor
184	When CV2 was depleted in the Xenopus embryo, the early phenotype observed was one of increased BMP signaling, indicating that a main function of CV2 is to serve as a BMP4 feedback inhibitor (Figure 1). Our results in Xenopus contrast with a previous report in-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	When CV2 was deplete>>>a previous report in
185	zebrafish that reached a different conclusion (Rentzsch et al., 2006). The finding that CV2-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	zebrafish that reach>>>The finding that CV2
186	protein functions as an overall anti-BMP molecule in Xenopus is strongly supported by the fact that CV2 and Chordin MOs cooperate with each other to ventralize the embryo (Figure 2). At later stages of development, zebrafish anti-CV2 MO showed loss of the ventral fin (Rentzsch et al., 2006;Moser et al., 2007) and, in agreement with this, we observed a similar phenotype in Xenopus. The development of the ventral fin is thought to reflect the pro-BMP activity of-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	protein functions as>>> pro-BMP activity of
187	Chordin, which is transported together with BMP towards the ventral side (Little and Mullins, 2006). Thus, our data may suggest that the pro-BMP effects of CV2 are mediated by an analogous flux of Chordin/BMP to the ventral side of the embryo.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Chordin, which is tr>>> side of the embryo.
188	CV2 Concentrates Chordin/BMP would concentrate Chordin and its BMP complexes at the ventral center of the Xenopus embryo (Figure 7A, flux indicated by red arrow).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	CV2 Concentrates Cho>>>cated by red arrow).
189	The principal biochemical finding reported here is that CV2 binds full-length Chordin with-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	The principal bioche>>>-length Chordin with
190	high affinity. In Figure 7 we present a revised model for Xenopus D-V patterning based on our biochemical and phenotypic results and on current thinking on how the crossveins are formed in Drosophila (O'Connor et al., 2006;Blair, 2007). We propose that the pro-BMP effects of CV2 are caused in part by of its action on Chordin/Tsg/BMP complexes diffusing to sites of high 12CV2 expression in the ventral side of the embryo. On the dorsal side of the Xenopus embryo, Chordin would predominantly bind ADMP (Anti-Dorsalizing Morphogenetic-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	high affinity. In Fi>>>lizing Morphogenetic
191	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
192	Page 7-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 7>>>Page 7
193	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
194	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
195	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
196	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
197	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
198	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
199	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
200	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
201	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
202	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
203	Protein), a BMP-like molecule that plays an important role in the self-regulation of D-V pattern (Figure 7;Reversade and De Robertis, 2005). Tsg binds to both CV2 and Chordin, making them better BMP antagonists, as well as to BMP4 (facilitating BMP4 signaling in the absence of-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Protein), a BMP-like>>>ng in the absence of
204	CV2 and Chordin) (Figure 7A). CV2 would provide localized binding sites for Chordin/BMP, regulating the shape of the D-V patterning gradient. CV2 does not diffuse far from its site of synthesis, due to a strong membrane/extracellular matrix heparin sulfate proteoglycan (HSPG) binding site in its vWFd domain (Rentzsch et al., 2006). In Drosophila, CV2 binds to the GPI membrane-tethered HSPG Dally and is not able to signal beyond one or two cell diameters in wing clones (Serpe et al., 2008). CV2 undergoes autocatalytic cleavage (Lidell et al., 2003) and is resistant to degradation by tolloids (Figure 2). However, Chordin and Chordin/BMP-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	CV2 and Chordin) (Fi>>>rdin and Chordin/BMP
205	complexes are readily cleaved by ventrally-expressed Xlr. Thus, binding of Chordin to CV2-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	complexes are readil>>>ng of Chordin to CV2
206	Ventral Chordin/Tsg/BMP4 complexes would face two alternative fates. First, in the absence of tolloids they would be inactivated and removed by CV2 binding. In this respect, it is-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Ventral Chordin/Tsg/>>> this respect, it is
207	interesting to note that the binding of BMP/Chordin to CV2 is of higher affinity than that of full-length Chordin alone, so this anti-BMP effect could be very efficient. Second, in the-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	interesting to note >>>ient. Second, in the
208	presence of tolloid, complexes of Chordin with BMPs (perhaps pre-bound to CV2, see Figure 7B) would be cleaved, releasing active BMPs that would bind to BMPRs to achieve peak BMP signaling ventrally (Piccolo et al., 1997; Reversade and De Robertis, 2005). CV2 has a high-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	presence of tolloid,>>>005). CV2 has a high
209	affinity for the proteolytic fragments of Chordin digestion, and this could further facilitate BMP signaling by retaining spent Chordin fragments and releasing BMP.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	affinity for the pro>>>s and releasing BMP.
210	This model of extracellular protein-protein interactions is supported by the phenotypic effects of CV2 depletion in Xenopus. In wild type embryos, endogenous CV2 had an overall anti-BMP function. However, CV2-depleted embryos became hypersensitive to the dorsalizing effects-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	This model of extrac>>> dorsalizing effects
211	of injected Chordin protein or DN-Xlr mRNA (Figure 6). This suggests that CV2 inhibits excess Chordin in the embryo. Remarkably, Chordin overexpression or Xlr inhibition reversed the net effect of CV2 knockdown, revealing a pro-BMP activity for endogenous CV2. This anti--->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	of injected Chordin >>>nous CV2. This anti-
212	Chordin activity should remain localized to the ventral side of the embryo since CV2 is not-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Chordin activity sho>>>ryo since CV2 is not
213	diffusible (Rentzsch et al., 2006;Serpe et al., 2008). By removing Chordin ventrally, CV2 could facilitate BMP signaling. In addition, any BMP/Chordin complexes reaching the ventral side can also signal, provided Xlr proteolytic activity is available. In conclusion, both embryological and biochemical experiments suggest that interactions between CV2 and Chordin play a key role in Xenopus D-V patterning.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	diffusible (Rentzsch>>>opus D-V patterning.
214	It should at this point be noted that while overexpressed Chordin clearly diffuses long-range in Xenopus, and endogenous Sog has been shown to diffuse along the entire Drosophila-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	It should at this po>>>he entire Drosophila
215	embryonic D-V axis (O'Connor et al., 2006), the range of action for endogenous Xenopus-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	embryonic D-V axis (>>>r endogenous Xenopus
216	Chordin protein remains the subject of active inquiry. If Chordin normally exerts its anti-BMP effects over a relatively short range, the functional Chordin gradient observed in vivo may arise from a "summation" of proteins secreted from different tissues, downstream of distinct-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Chordin protein rema>>>wnstream of distinct
217	transcriptional controls (Blitz et al., 2000). Recently, diffusion of microinjected BMP4 from the dorsal to the ventral side of the Xenopus gastrula has been directly visualized and shown to require endogenous Chordin (Ben-Zvi et al., 2008). Regardless of the origin of the relevant Chordin protein, our data demonstrate that CV2 coordinates both anti-BMP and pro-BMP Chordin functions on the ventral side of the embryo.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	transcriptional cont>>> side of the embryo.
218	Comparison between Xenopus and Drosophila CV2 possibility is that the cleavage of Chordin or Sog by tolloids might take place on Chordin/Tsg/ BMP already bound to CV2 (Figure 7B). Since we have observed that mouse CV2 associates with BMPR-1a in vitro, this interaction might also facilitate BMPR signaling in vertebrates. The Chordin digestion products, which have an even higher affinity for CV2 than full-length Chordin (Figure 5D), would remain attached to CV2 and be removed, perhaps by endocytosis. This extracellular machinery would ensure that peak BMP signaling is achieved in the ventral center.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Comparison between X>>> the ventral center.
219	The proposed role of CV2 as a regulator of the flux of Chordin/BMP complexes (Figure 7) may explain only part of its pro-BMP effects. A recent study in Drosophila has shown that-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	The proposed role of>>>phila has shown that
220	CV2 binds specifically to the BMP type I receptor Thickveins (Tkv), suggesting that CV2 may-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	CV2 binds specifical>>>gesting that CV2 may
221	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
222	Page 8-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 8>>>Page 8
223	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
224	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
225	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
226	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
227	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
228	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
229	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
230	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
231	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
232	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
233	promote BMP signaling by facilitating transfer to BMPR (Serpe et al., 2008). We have been able to confirm this binding for vertebrate proteins, using commercial BMPR-1a (ALK-3) and CV2 mouse proteins (unpublished observations). A mathematical model was proposed to-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	promote BMP signalin>>>odel was proposed to
234	explain how high levels of CV2 would inhibit BMP signaling and lower levels could enhance signalling (Serpe et al., 2008). Our finding that Chordin/BMP complexes bind avidly to CV2 complements and enriches this model. In the Drosophila wing, Sog/Tsg2/Dpp complexes diffuse long-range from the longitudinal veins to the crossveins, where Dpp is released by-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	explain how high lev>>>e Dpp is released by
235	Tolloid-related (Ralston and Blair, 2005;Blair, 2007). The crossveins are sites of peak BMP signaling. CV2 protein remains tethered to its site of synthesis in crossveins (Serpe et al., 2008), and could serve to concentrate diffusible Sog/Tsg2/Dpp complexes. An interesting-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Tolloid-related (Ral>>>exes. An interesting
236	In conclusion, the finding that CV2 binds to Chordin will help develop mechanistic models for the diverse CV2 activities described in the literature. The important discovery by Serpe et al. (2008) that CV2 also binds to Tkv greatly increases the regulatory possibilities of this system. The biochemical pathway involving Chordin, BMP, Tsg, Tolloid and CV2 proteins has revealed a new paradigm for the exquisite extracellular regulation of embryonic cell differentiation. This pathway is ancestral to D-V patterning of all bilateral animals, since the entire system has been conserved during evolution (De Robertis, 2008).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	In conclusion, the f>>>(De Robertis, 2008).
237	MATERIALS AND METHODS-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->['U']--->title	MATERIALS AND METHOD>>>ATERIALS AND METHODS
238	Morpholino Oligomers, mRNA and Protein Injections-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Morpholino Oligomers>>>d Protein Injections
239	Morpholino antisense oligomers (MO) were obtained from Gene Tools. The CV2 MO used in most of this study had the sequence 5-TGCCAGTGGAGAAGCAGCTGTGCAT-3. CV2-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Morpholino antisense>>>AGCAGCTGTGCAT-3. CV2
240	MO1 and CV2 MO2, used as additional specificity controls, target the CV2 mRNA 5UTR and had the sequences 5-TATAGCATCCAGACTGTTGCAGGTT-3 and 5--->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	MO1 and CV2 MO2, use>>>TGTTGCAGGTT-3 and 5-
241	TTAGAGTGAGGAGTCAAGAACAGAG-3 respectively. Other MOs were as described: Chordin MO (Oelgeschläger et al., 2003), Tsg MO (Blitz et al., 2003), and BMP4 MO-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	TTAGAGTGAGGAGTCAAGAA>>>, 2003), and BMP4 MO
242	(Reversade and De Robertis, 2005). Each MO was microinjected (500 M or 250 M, 4 nL) four times radially into 2- or 4-cell embryos. For mRNA injections, a full-length Xenopus CV2 EST clone (#XL039c09) was used as a template for PCR. 5 and 3 untranslated regions were deleted, a Flag-tagged signal peptide (Piccolo et al., 1997) was added, and cloned into pCS2 to generate FL-CV2, Nter-CV2 and Cter-CV2. Synthetic mRNAs were prepared by linearizing with NotI, transcribed with SP6 polymerase, and 500 pg injected. The three mRNAs produced Flag-tagged proteins of the expected size in microinjected embryos (data not shown).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(Reversade and De Ro>>>os (data not shown).
243	Recombinant mouse CV2 or Tsg proteins (R&D Systems) were microinjected (5 M, 40 nL) into the blastocoele at late blastula stage (stage 9.5). The most effective dose of Chordin protein for injections was 60 nL at 2 M. Procedures for whole-mount in situ hybridization are available at  www.hhmi.ucla.edu/derobertis/index.html.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Recombinant mouse CV>>>robertis/index.html.
244	Biochemical Methods as loading control. Protein extracts were made from at least 10 embryos for each sample. For in vitro digestions, 30 nM Chordin-Myc or 50 nM recombinant mouse CV2 were incubated in Xld buffer (Piccolo et al., 1997) with 2 nM affinity-purified Xlr-Flag (Lee et al., 2006) or with 293T cells xBMP1-transfected conditioned medium at 25°C for 18 h. Goat anti-mouse CV2 antibody (R&D Systems) was diluted 1:2000 for Western blots.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Biochemical Methods >>>0 for Western blots.
245	Recombinant mouse CV2, mouse Tsg, mouse Chordin and human BMP4 were purchased from R&D Systems, and Xenopus Chordin-Myc was produced in baculovirus (Piccolo et al., 1996). Phospho-Smad1 was detected in whole embryos using anti-phospho-Smad1/Smad5/ Smad8 antibody (1:1000, Cell Signaling Technology) and anti-total Smad1 (1:1000, Zymed)-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Recombinant mouse CV>>>mad1 (1:1000, Zymed)
246	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
247	Page 9-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 9>>>Page 9
248	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
249	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
250	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
251	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
252	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
253	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
254	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
255	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
256	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
257	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
258	For in vitro autocatalytic cleavage, 50 nM recombinant mouse CV2 was incubated at 37°C in citric acid-Na2HPO4 (McIlvaine buffer) at varying pH for 18 h. For crosslinking, the indicated proteins were incubated in PBS for at least 1 h at room temperature. Disuccinimidyl suberate (DSS, Pierce) was added to a final concentration of 1 mM, incubated with agitation for 45 min at room temperature, and the reaction stopped by adding Tris-HCl (pH 8) to a final-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	For in vitro autocat>>>Cl (pH 8) to a final
259	concentration of 50 mM. Samples were directly separated on SDS gels under reducing-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	concentration of 50 >>> gels under reducing
260	conditions. For co-immunoprecipitation, the indicated proteins were incubated overnight at 4°-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	conditions. For co-i>>>ated overnight at 4°
261	C in TS buffer (20 mM Tris pH 7.5; 150 mM NaCl; 1.5 mM CaCl2; 1.5 mM MgCl2).-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->parr	C in TS buffer (20 m>>>aCl2; 1.5 mM MgCl2).
262	Anti-mouse CV2 antibody (R&D systems) was bound to protein G agarose (Pierce) and 20l of beads added to each reaction. In some cases, CV2 was pre-bound to CV2 antibody beads-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Anti-mouse CV2 antib>>>o CV2 antibody beads
263	and washed prior to incubation with the other proteins. For the binding of Chordin fragments to CV2, 25 nM Chordin-Myc was incubated with 2 nM purified Xlr-PC (Lee et al., 2006) for 15 min or 2 h at 25°C. Metalloproteinase reactions were stopped by addition of 1 mM of the zinc chelator 1­10 orthophenanthroline on ice. All biochemical experiments were repeated at least two times.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	and washed prior to >>> at least two times.
264	For BMP receptor binding assays, recombinant mouse CV2, mouse Tsg, and human BMP4-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	For BMP receptor bin>>> Tsg, and human BMP4
265	were preincubated at room temperature for 1 h, and BMPR IB-Fc protein (R&D Systems) was added for an additional hour. BMP bound to the BMPR was detected by anti-BMP4 Western blot after protein A precipitation of the receptor (Larraín et al., 2001).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	were preincubated at>>>rraín et al., 2001).
266	For quantitative RT-PCR (qRT-PCR), total RNA was extracted from pools of five embryos with Absolute RNA MicroPrep Kit, reverse transcribed, and analyzed in a MX3000P apparatus using Brilliant SYBR GREEN QPCR Master Mix (Stratagene).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	For quantitative RT->>>er Mix (Stratagene).
267	Surface Plasmon Resonance (SPR) Analyses-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Surface Plasmon Reso>>>nance (SPR) Analyses
268	SPR measurements were performed on a Biacore 3000 system. Recombinant Chordin was-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	SPR measurements wer>>>ombinant Chordin was
269	dissolved at 10 g/ml in 10 mM sodium acetate (pH 5.0) and immobilized on a CM5 (carboxy methylcellulose) sensor chip using the amine coupling method to a level of about 2500 response units. Binding and washes were performed in PBS using recombinant mouse CV2 protein-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	dissolved at 10 g/ml>>>nt mouse CV2 protein
270	dissolved in the same buffer. Each experimental cycle consisted of a flow of commercial CV2 at indicated concentrations followed by washes with buffer alone. After each cycle, chip-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	dissolved in the sam>>>ter each cycle, chip
271	surfaces were regenerated by removing non-crosslinked proteins with 10 mM HCl. Data were analyzed with BIAevaluation 4.1 software and curve-fitting was done with the assumption of one-to-one binding (Wang et al., 2003).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	surfaces were regene>>>(Wang et al., 2003).
272	Supplementary Material-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->title	Supplementary Materi>>>pplementary Material
273	Refer to Web version on PubMed Central for supplementary material.-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Refer to Web version>>>plementary material.
274	Acknowledgments-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->title	Acknowledgments>>>Acknowledgments
275	We thank members of our laboratory for comments on the manuscript, N. Ketpura, A. Mays and C. Zer for help with preliminary studies, and Drs. M. O'Connor and S. Blair for sharing results before publication. D. Geissert and T. Boe provided expert technical assistance. V.F.T. thanks Drs. C. Wylie and J. Heasman for help with the oocyte CV2 core facility led by Dr. R. Lehrer for help with the Biacore analyses. This work was supported by NIH grant HD21502-22. E.M.D.R is an investigator of the Howard Hughes Medical Institute.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->parr	We thank members of >>>s Medical Institute.
276	depletion experiment carried out at the Cold Spring Harbor Xenopus Embryology course. We are grateful to the UCLA-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->parr	depletion experiment>>>grateful to the UCLA
277	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
278	Page 10-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 10>>>Page 10
279	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
280	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
281	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
282	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
283	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
284	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
285	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
286	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
287	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
288	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
289	References-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->title	References>>>References
290	Ben-Zvi D, Shilo BZ, Fainsod A, Barkai N. Scaling of the BMP activation gradient in Xenopus embryos. Nature. 2008in press-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Ben-Zvi D, Shilo BZ,>>>Nature. 2008in press
291	Binnerts ME, Wen X, Cante-Barrett K, Bright J, Chen HT, Asundi V, Sattari P, Tang T, Boyle B, Funk W, Rupp F. Human Crossveinless-2 is a novel inhibitor of bone morphogenetic proteins. Biochem Biophys Res Commun 2004;315:272­280. [PubMed: 14766204]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Binnerts ME, Wen X, >>>. [PubMed: 14766204]
292	Blair SS. Wing vein patterning in Drosophila and the analysis of intercellular signaling. Annu Rev Cell Dev Biol 2007;23:293­319. [PubMed: 17506700]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Blair SS. Wing vein >>>. [PubMed: 17506700]
293	Blitz IL, Chow KW, Chang C. Twisted gastrulation loss-of-function analyses support its role as a BMP inhibitor during early Xenopus embryogenesis. Development 2003;130:4975­4988. [PubMed: 12952901]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Blitz IL, Chow KW, C>>>. [PubMed: 12952901]
294	Blitz IL, Shimmi O, Wünnenberg-Stapleton K, O'Connor MB, Cho KW. Is chordin a long-range- or short-range-acting factor? Roles for BMP1-related metalloproteases in chordin and BMP4 autofeedback loop regulation. Dev Biol 2000;223:120­138. [PubMed: 10864466]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Blitz IL, Shimmi O, >>>. [PubMed: 10864466]
295	Coffinier C, Ketpura N, Tran U, Geissert D, De Robertis EM. Mouse Crossveinless-2 is the vertebrate homolog of a Drosophila extracellular regulator of BMP signaling. Mech Dev 2002;119:179­184.-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Coffinier C, Ketpura>>>ev 2002;119:179­184.
296	Coles E, Christiansen J, Economou A, Bronner-Fraser M, Wilkinson DG. A vertebrate crossveinless 2 homologue modulates BMP activity and neural crest cell migration. Development 2004;131:5309­ 5317. [PubMed: 15456729]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Coles E, Christianse>>>. [PubMed: 15456729]
297	Conley CA, Silburn R, Singer MA, Ralston A, Rohwer-Nutter D, Olson DJ, Gelbart W, Blair SS. Crossveinless 2 contains cysteine-rich domains and is required for high levels of BMP-like activity during the formation of the cross veins in Drosophila. Development 2000;127:3947­3959. [PubMed: 10952893]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Conley CA, Silburn R>>>. [PubMed: 10952893]
298	Dale L, Evans W, Goodman SA. Xolloid-related: a novel BMP1/Tolloid-related metalloprotease is expressed during early Xenopus development. Mech Dev 2002;119:177­190. [PubMed: 12464431]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Dale L, Evans W, Goo>>>. [PubMed: 12464431]
299	De Robertis EM. Spemann's organizer and self-regulation in amphibian embryos. Nat Rev Mol Cell Biol 2006;7:296­302. [PubMed: 16482093]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	De Robertis EM. Spem>>>. [PubMed: 16482093]
300	De Robertis EM. Evo-devo: variations on ancestral themes. Cell 2008;132:185­195. [PubMed: 18243095]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	De Robertis EM. Evo->>>. [PubMed: 18243095]
301	Ikeya M, Kawada M, Kiyonari H, Sasai N, Nakao K, Furuta Y, Sasai Y. Essential pro-Bmp roles of crossveinless 2 in mouse organogenesis. Development 2006;133:4463­4473. [PubMed: 17035289]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Ikeya M, Kawada M, K>>>. [PubMed: 17035289]
302	Kamimura M, Matsumoto K, Koshiba-Takeuchi K, Ogura T. Vertebrate crossveinless 2 is secreted and acts as an extracellular modulator of the BMP signaling cascade. Dev Dyn 2004;230:434­445. [PubMed: 15188429]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Kamimura M, Matsumot>>>. [PubMed: 15188429]
303	Larraín J, Oelgeschläger M, Ketpura NI, Reversade B, Zakin L, De Robertis EM. Proteolytic cleavage of Chordin as a switch for the dual activities of Twisted gastrulation in BMP signaling. Development 2001;128:4439­4447. [PubMed: 11714670]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Larraín J, Oelgeschl>>>. [PubMed: 11714670]
304	Lee HX, Ambrosio AL, Reversade B, De Robertis EM. Embryonic dorsal-ventral signaling: secreted Frizzled-related Proteins as inhibitors of Tolloid proteinases. Cell 2006;124:147­159. [PubMed: 16413488]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Lee HX, Ambrosio AL,>>>. [PubMed: 16413488]
305	Lidell ME, Johansson ME, Hansson GC. An autocatalytic cleavage in the C terminus of the human MUC2 mucin occurs at the low pH of the late secretory pathway. J Biol Chem 2003;278:13944­13951. [PubMed: 12582180] O'Connor MB, Umulis D, Othmer HG, Blair SS. Shaping BMP morphogen gradients in the Drosophila embryo and pupal wing. Development 2006;33:183­193.-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Lidell ME, Johansson>>>ent 2006;33:183­193.
306	Little SC, Mullins MC. Twisted gastrulation promotes BMP signaling in zebrafish dorsal-ventral axial patterning. Development 2004;131:5825­5835. [PubMed: 15525664]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Little SC, Mullins M>>>. [PubMed: 15525664]
307	Little SC, Mullins MC. Extracellular modulation of BMP activity in patterning the dorsoventral axis. Birth Defects Res C Embryo Today 2006;78:224­242. [PubMed: 17061292]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Little SC, Mullins M>>>. [PubMed: 17061292]
308	Moser M, Binder O, Wu Y, Aitsebaomo J, Ren R, Bode C, Bautch VL, Conlon FL, Patterson C. BMPER, a novel endothelial cell precursor-derived protein, antagonizes bone morphogenetic protein signaling and endothelial cell differentiation. Mol Cell Biol 2003;23:5664­5679. [PubMed: 12897139]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Moser M, Binder O, W>>>. [PubMed: 12897139]
309	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
310	Page 11-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 11>>>Page 11
311	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
312	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
313	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
314	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
315	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
316	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
317	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
318	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
319	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
320	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
321	Moser M, Yu Q, Bode C, Xiong JW, Patterson C. BMPER is a conserved regulator of hematopoietic and vascular development in zebrafish. J Mol Cell Cardiol 2007;43:243­253. [PubMed: 17618647]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Moser M, Yu Q, Bode >>>. [PubMed: 17618647]
322	Oelgeschläger M, Larraín J, Geissert D, De Robertis EM. The evolutionarily conserved BMP-binding protein Twisted gastrulation promotes BMP signalling. Nature 2000;405:757­763. [PubMed: 10866189]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Oelgeschläger M, Lar>>>. [PubMed: 10866189]
323	Oelgeschläger M, Kuroda H, Reversade B, De Robertis EM. Chordin is required for the Spemann-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Oelgeschläger M, Kur>>>ired for the Spemann
324	organizer transplantation phenomenon in Xenopus embryos. Dev Cell 2003;4:219­230. [PubMed: 12586065]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	organizer transplant>>>. [PubMed: 12586065]
325	Piccolo S, Sasai Y, Lu B, De Robertis EM. Dorsoventral patterning in Xenopus: Inhibition of ventral signals by direct binding of Chordin to BMP-4. Cell 1996;86:589­598. [PubMed: 8752213]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Piccolo S, Sasai Y, >>>8. [PubMed: 8752213]
326	Piccolo S, Agius E, Lu B, Goodman S, Dale L, De Robertis EM. Cleavage of Chordin by the Xolloid metalloprotease suggests a role for proteolytic processing in the regulation of Spemann organizer activity. Cell 1997;91:407­416. [PubMed: 9363949]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Piccolo S, Agius E, >>>6. [PubMed: 9363949]
327	Ralston A, Blair SS. Long-range Dpp signaling is regulated to restrict BMP signaling to a crossvein competent zone. Dev Biol 2005;280:187­200. [PubMed: 15766758]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Ralston A, Blair SS.>>>. [PubMed: 15766758]
328	Rentzsch F, Zhang J, Kramer C, Sebald W, Hammerschmidt M. Crossveinless 2 is an essential positive feedback regulator of Bmp signaling during zebrafish gastrulation. Development 2006;133:801­811. [PubMed: 16439480]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Rentzsch F, Zhang J,>>>. [PubMed: 16439480]
329	Reversade B, De Robertis EM. Regulation of ADMP and BMP2/4/7 at opposite embryonic poles-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Reversade B, De Robe>>>site embryonic poles
330	generates a self-regulating morphogenetic field. Cell 2005;123:1147­1160. [PubMed: 16360041]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	generates a self-reg>>>. [PubMed: 16360041]
331	Ross JJ, Shimmi O, Vilmos P, Petryk A, Kim H, Gaudenz K, Hermanson S, Ekker SC, O'Connor MB, Marsh JL. Twisted gastrulation is a conserved extracellular BMP antagonist. Nature 2001;410:479­ 483. [PubMed: 11260716]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Ross JJ, Shimmi O, V>>>. [PubMed: 11260716]
332	Sasai Y, Lu B, Steinbeisser H, De Robertis EM. Regulation of neural induction by the Chd and Bmp-4 antagonistic patterning signals in Xenopus. Nature 1995;376:333­336. [PubMed: 7630399]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Sasai Y, Lu B, Stein>>>6. [PubMed: 7630399]
333	Serpe M, Umulis D, Ralston A, Chen J, Olson DJ, Othmer H, O'Connor MB, Blair SS. The cell-tethered BMP binding protein Crossveinless 2 is a short-range co-receptor that promotes or inhibits BMP-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Serpe M, Umulis D, R>>>otes or inhibits BMP
334	signaling in a concentration dependant manner. Dev Cell 2008;14:940­953. [PubMed: 18539121] Shimmi O, Ralston A, Blair SS, O'Connor MB. The crossveinless gene encodes a new member of the-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	signaling in a conce>>> a new member of the
335	Twisted gastrulation family of BMP-binding proteins which, with Short gastrulation, promotes BMP signaling in the crossveins of the Drosophila wing. Dev Biol 2005;282:70­83. [PubMed: 15936330] Vilmos P, Sousa-Neves R, Lukacsovich T, Marsh JL. Crossveinless defines a new family of Twisted--->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Twisted gastrulation>>>w family of Twisted-
336	gastrulation-like modulators of bone morphogenetic protein signalling. EMBO Rep 2005;6:262­267. [PubMed: 15711536]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	gastrulation-like mo>>>. [PubMed: 15711536]
337	Wang W, Cole AM, Hong T, Waring AJ, Lehrer RI. Retrocyclin, an antiretroviral theta-defensin, is a lectin. J Immunol 2003;170:4708­4716. [PubMed: 12707350]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Wang W, Cole AM, Hon>>>. [PubMed: 12707350]
338	Xie J, Fisher S. Twisted gastrulation enhances BMP signaling through chordin dependent and independent mechanisms. Development 2005;132:383­391. [PubMed: 15604098]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Xie J, Fisher S. Twi>>>. [PubMed: 15604098]
339	Zhang JL, Huang Y, Qiu LY, Nickel J, Sebald W. von Willebrand factor type C domain-containing-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Zhang JL, Huang Y, Q>>> C domain-containing
340	proteins regulate bone morphogenetic protein signaling through different recognition mechanisms. J Biol Chem 2007;282:20002­20014. [PubMed: 17483092]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	proteins regulate bo>>>. [PubMed: 17483092]
341	Zhang JL, Qiu LY, Kotzsch A, Weidauer S, Patterson L, Hammerschmidt M, Sebald W, Mueller TD.-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Zhang JL, Qiu LY, Ko>>>ebald W, Mueller TD.
342	Crystal structure Analysis Reveals How the Chordin Family Member Crossveinless 2 Blocks BMP-2 Receptor Binding. Dev Cell 2008;14:739­750. [PubMed: 18477456]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Crystal structure An>>>. [PubMed: 18477456]
343	Zimmerman LB, De Jesus-Escobar JM, Harland RM. The Spemann organizer signal noggin binds and inactivates bone morphogenetic protein 4. Cell 1996;86:599­606. [PubMed: 8752214]-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->parr	Zimmerman LB, De Jes>>>6. [PubMed: 8752214]
344	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
345	Page 12-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 12>>>Page 12
346	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
347	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
348	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
349	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
350	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
351	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
352	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
353	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
354	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
355	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
356	Figure 1. CV2 is a Secreted BMP Feedback Inhibitor-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->capfig	Figure 1. CV2 is a S>>>P Feedback Inhibitor
357	(A) Normal CV2 expression at stage 22 (hemisection). vb, ventral blastopore (B) CV2MO microinjection increases CV2 expression. (C) The CV2 negative feedback loop requires BMP4. For each experimental sample at least 25 embryos were examined, with similar results. (D) qRT-PCR showing increased expression of the ventral marker Vent1 in CV2-depleted embryos. (E) CV2 depletion reduces expression of the dorsal/forebrain marker Six3. (F) Endogenous Smad1 phosphorylation is increased by CV2 depletion at gastrula and neurula stages 12, 13 and 14. A pSmad1 signal was detectable in the stage 14 uninjected lane upon longer exposure. Total Smad1 antibody (T-Smad1) staining was used as loading control.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(A) Normal CV2 expre>>> as loading control.
358	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
359	Page 13-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 13>>>Page 13
360	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
361	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
362	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
363	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
364	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
365	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
366	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
367	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
368	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
369	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
370	Figure 2. CV2 and Chordin Compensate for Each Other in Xenopus D-V Patterning-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->capfig	Figure 2. CV2 and Ch>>>nopus D-V Patterning
371	(A) Uninjected embryo showing CV2 expression, which is used here as a BMP4 signaling readout (n=17). Inset shows mid-gastrula embryo stained for Chordin (Chd) and Sizzled (Szl) (n=24). (B) CV2 depletion upregulates its own expression (n=15), as well as increasing Szl and decreasing Chd (n=20). (C) Depletion of the BMP antagonist Chordin also increases the ventral CV2 and Szl expression domains (n=13 and n=18, respectively). (D) When co-injected, CV2 MO and Chd MO show a marked expansion of the CV2 and Szl expression domains (n=15 and n=25, respectively). (E­H) qRT-PCR analyses of single and double CV2 and Chd morphants for the D-V markers Szl, CV2, Gsc and Chd at late gastrula stage 12.5. (I) Endogenous Smad1 phosphorylation is increased by co-injection of Chd MO and CV2 MO in stage 11 embryos. (J) The CV2 cleavage sequence contains the conserved low-pH GDPH autocatalytic site present in mucins. hMuc2, human mucin-2.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(A) Uninjected embry>>>Muc2, human mucin-2.
372	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
373	Page 14-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 14>>>Page 14
374	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
375	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
376	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
377	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
378	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
379	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
380	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
381	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
382	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
383	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
384	(K) Chordin, but not full-length CV2, is cleaved by the extracellular zinc-metalloproteinases Xolloid-related (Xlr) and BMP1 (lanes 1­6). However, cleavage of full-length CV2 (80 kD band) is triggered by low pH (lanes 9 and 10). (L­N) Ventral injections of mRNAs encoding full-length CV2 (CV2-FL, n=56, of which 95% had partial secondary axes, three independent experiments), N-terminal CV2 fragment terminating at the GDPH cleavage site (CV2 N-Ter, n=42, no secondary axes observed), or a secreted C-terminal fragment encoding most of the vWFd domain (CV2 C-Ter, n=45, no secondary axes observed). The insets show injected embryos at late neurula stage hybridized with the pan-neural marker Sox2.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(K) Chordin, but not>>>-neural marker Sox2.
385	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
386	Page 15-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 15>>>Page 15
387	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
388	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
389	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
390	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
391	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
392	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
393	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
394	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
395	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
396	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
397	Figure 3. Twisted-Gastrulation (Tsg) is Required for the Effects of CV2 Loss-of-Function and Overexpression-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->capfig	Figure 3. Twisted-Ga>>>n and Overexpression
398	(A) Simultaneous depletion of CV2 and Chordin strikingly increased CV2 expression, reflecting increased BMP signaling (see Figure S5 for controls). (B) The effects of CV2 MO and Chd MO require Tsg activity (pro-BMP effect of Tsg). (C) CV2 protein injection into the blastula cavity induces strong dorsalization of the Xenopus embryo, as indicated by the expansion of the dorsal markers Xag1, Six3, and Krox20 (n=12, all strongly dorsalized). Inset shows an uninjected embryo. (D) CV2 protein requires endogenous Tsg for its anti-BMP activity (n=10, all embryos similarly affected). Inset shows Tsg MO injected embryo.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(A) Simultaneous dep>>> MO injected embryo.
399	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
400	Page 16-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 16>>>Page 16
401	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
402	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
403	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
404	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
405	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
406	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
407	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
408	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
409	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
410	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
411	(E) CV2 protein injection expands the neural tube (n=17). Inset shows uninjected embryo. (F) Tsg and CV2 protein co-injection renders CV2 a stronger BMP antagonist, expanding the nervous system marked by Sox3 (n=16, all co-injected embryos were more dorsalized than those injected with CV2 protein alone despite some individual variations). Inset shows embryo injected with Tsg protein alone.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(E) CV2 protein inje>>>h Tsg protein alone.
412	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
413	Page 17-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 17>>>Page 17
414	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
415	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
416	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
417	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
418	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
419	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
420	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
421	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
422	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
423	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
424	Figure 4. CV2, BMP4 and Tsg form a Ternary Complex that Inhibits BMP Signaling-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->capfig	Figure 4. CV2, BMP4 >>>hibits BMP Signaling
425	(A) DSS crosslinking showing that CV2 binds BMP4 directly.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(A) DSS crosslinking>>>binds BMP4 directly.
426	(B) CV2 dose-dependently blocks BMP4-induced phosphorylation of endogenous Smad1 in mouse L-cells; BMP4 was added for 30 min in serum-free medium after pre-incubation with CV2 protein for 2 hours at 4°C.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(B) CV2 dose-depende>>> for 2 hours at 4°C.
427	(C) Co-immunoprecipitation demonstrating that purified CV2 binds Tsg. (D) Tsg facilitates the binding of CV2 to BMP4.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(C) Co-immunoprecipi>>>ding of CV2 to BMP4.
428	(E) CV2, BMP4 and Tsg form a ternary complex. Left panel shows DSS crosslinking products stained with anti-CV2 antibody. Right panel, same samples examined with anti-BMP-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(E) CV2, BMP4 and Ts>>>amined with anti-BMP
429	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
430	Page 18-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 18>>>Page 18
431	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
432	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
433	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
434	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
435	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
436	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
437	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
438	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
439	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
440	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
441	monoclonal antibody (anti-Tsg antibody showed smears due to crosslinking of Tsg with itself). Tsg protein alone is not recognized by either antibody (not shown). (F) CV2 and Tsg additively block the binding of BMP4 to BMPR-1b-Fc. (G) Model of the molecular interactions of CV2, Tsg and BMP4 in a ternary complex.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	monoclonal antibody >>>n a ternary complex.
442	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
443	Page 19-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 19>>>Page 19
444	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
445	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
446	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
447	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
448	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
449	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
450	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
451	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
452	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
453	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
454	Figure 5. CV2 and Chordin Bind to Each Other-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->capfig	Figure 5. CV2 and Ch>>>n Bind to Each Other
455	(A) Biacore sensograms of the CV2-Chordin interaction in real-time showing an average KD of 1.37 nM. The time at which the binding of CV2 protein stops and the buffer wash starts is indicated.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(A) Biacore sensogra>>>starts is indicated.
456	(B) Co-immunoprecipitation in solution showing that Chordin and BMP4 bind better to CV2 in the presence of each other. Top panel shows Western blot immunostained with anti-Chordin, middle panel with monoclonal anti-BMP4, and bottom panel (loading control) with anti-CV2 antibody.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(B) Co-immunoprecipi>>>h anti-CV2 antibody.
457	(C) CV2, Chordin and BMP4 form a ternary complex. Left panel shows crosslinked products stained with BMP4 monoclonal antibody; the antigenicity of BMP4 in crosslinked complexes with Chd and CV2 increases (the unbound BMP4 dimer band indicates the amount of BMP4 protein present in the complexes). The right panel the same products stained for myc-tagged Xenopus Chordin protein. The position of the BMP4/CV2/Chordin ternary complex is indicated.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(C) CV2, Chordin and>>>omplex is indicated.
458	(D) CV2 binds better to Chordin cleavage products than to Chordin full-length protein. Some cleavage products were present in the Chordin protein preparation, and these were enriched in lane 2.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(D) CV2 binds better>>> enriched in lane 2.
459	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
460	Page 20-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 20>>>Page 20
461	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
462	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
463	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
464	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
465	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
466	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
467	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
468	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
469	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
470	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
471	(E) BMP4 pre-bound to Chordin enhances the binding preference of CV2 beads for full-length Chordin (lane 4). At this exposure level the binding of full-length Chordin to CV2 is undetectable (lane 2), but is greatly increased by adding Xlr or BMP4 (lanes 3 and 4).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(E) BMP4 pre-bound t>>>MP4 (lanes 3 and 4).
472	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
473	Page 21-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 21>>>Page 21
474	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
475	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
476	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
477	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
478	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
479	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
480	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
481	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
482	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
483	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
484	Figure 6. The pro-BMP Function of CV2 is Revealed in Epistatic Experiments with Chordin or Tolloid-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->capfig	Figure 6. The pro-BM>>>h Chordin or Tolloid
485	(A) Expression of the eye field marker Rx2a in uninjected Xenopus late neurula embryo (n=45), anterior view. (B) Chordin protein injection (2 M, 60 nl) into the blastocoele at late blastula (stage 9.5) caused dorsalization and an increase in Rx2a expression (n=54). (C) CV2-depleted hosts were more sensitive to the anti-BMP effects of Chordin, as indicated by the expansion in the Rx2a domain (n=48). (D) Uninjected early neurula (stage 13, side view) showing Otx2 expression in the future forebrain and midbrain regions (n=19).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(A) Expression of th>>>rain regions (n=19).
486	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
487	Page 22-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 22>>>Page 22
488	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
489	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
490	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
491	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
492	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
493	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
494	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
495	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
496	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
497	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
498	(E) Chordin protein injection expands Otx2 in wild-type embryos (n=25).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(E) Chordin protein >>>type embryos (n=25).
499	(F) CV2 depletion sensitizes the embryo to the effects of Chordin on Otx2 (n=23). Note that the border of Otx2 expression expands posteriorly.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(F) CV2 depletion se>>>expands posteriorly.
500	(G­H) qRT-PCR analysis of the D-V markers Chd, CV2 and Szl after Chordin protein injection into wild-type and CV2-depleted embryos at late blastula. The bars indicate standard deviation between two groups of seven embryos each.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(G­H) qRT-PCR analys>>> seven embryos each.
501	(J and K) Anterior views of uninjected control or embryo microinjected four times with 250 pg of DN-Xlr mRNA, which inhibits the proteolytic degradation of Chordin. Note that the-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(J and K) Anterior v>>>ordin. Note that the
502	Otx2-positive forebrain (fb), midbrain, and cement gland (cg) regions are expanded, consistent with the anti-BMP effects of Tolloid inhibition (n=27).-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	Otx2-positive forebr>>>d inhibition (n=27).
503	(L) In CV2 depleted embryos Otx2 expression is greatly expanded by DN-Xlr mRNA (n=27). The dotted line indicates the eye field (eye), which is more weakly stained by Otx2.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->parr	(L) In CV2 depleted >>>kly stained by Otx2.
504	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
505	Page 23-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 23>>>Page 23
506	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
507	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
508	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
509	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
510	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
511	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
512	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
513	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
514	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
515	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
516	Figure 7. Model of the Molecular Interaction of CV2, Chordin, Tsg and BMP4-->id=5383, page=9, size=11, fam=Times, col=#000000, type=parrnote, textLines=107--->[]--->capfig	Figure 7. Model of t>>>hordin, Tsg and BMP4
517	(A) Model of the regulation of D-V patterning by a network of extracellular proteins secreted by the dorsal and ventral centers of the Xenopus gastrula. Arrows in black indicate direct-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(A) Model of the reg>>>lack indicate direct
518	protein-protein interactions in the extracellular space, blue arrows transcriptional regulation by the BMP-responsive transcription factors Smad1/5/8, and the red arrow the hypothetical-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	protein-protein inte>>>row the hypothetical
519	flux of Chordin/ADMP/BMP from the dorsal toward the ventral center of the embryo, where it would bind to CV2. This model of D-V patterning is self-regulating because at low BMP-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	flux of Chordin/ADMP>>>g because at low BMP
520	levels the transcription of the BMP-like molecule ADMP is activated, and at high-BMP levels the BMP antagonist CV2 and the tolloid inhibitor Sizzled are upregulated (Reversade and De Robertis, 2005; Lee et al., 2006). The function of Tsg is to both increase BMP inhibition by-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	levels the transcrip>>>se BMP inhibition by
521	CV2 and Chd and to promote BMP4 signaling in their absence. The tolloid protease Xlr cleaves Chordin/ADMP/BMP complexes, releasing active BMPs concentrated on the ventral side.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	CV2 and Chd and to p>>>on the ventral side.
522	(B) Model in which Chordin flow would help transport BMPs and Chordin from the dorsal to the ventral side of the Xenopus embryo. Three possible outcomes are indicated.-->id=2, page=0, size=13, fam=Helvetica, col=#000000, type=parr, textLines=559--->[]--->capfig	(B) Model in which C>>>comes are indicated.
523	Ambrosio et al.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Ambrosio et al.>>>Ambrosio et al.
524	Page 24-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Page 24>>>Page 24
525	Dev Cell. Author manuscript; available in PMC 2009 February 1.-->id=8, page=0, size=10, fam=Times, col=#000000, type=parrnote, textLines=82--->[]--->note	Dev Cell. Author man>>>PMC 2009 February 1.
526	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
527	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
528	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
529	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
530	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
531	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript
532	NIH-PA-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	NIH-PA>>>NIH-PA
533	Author-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Author>>>Author
534	Manuscript-->id=5, page=0, size=16, fam=Helvetica, col=#000000, type=title, textLines=224--->[]--->note	Manuscript>>>Manuscript